Labshake search
Citations for Addgene :
851 - 900 of 2566 citations for 6 Methylimidazo 2 1 b thiazole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... and a kanamycin resistance (from the plasmid pBBR1MCS-2 (55) purchased from Addgene 85168) ...
-
bioRxiv - Genetics 2021Quote: ... daf-16 (#34833) and daf-2 RNAi (#34834) clones were obtained from Addgene. mbl-1 RNAi was cloned from C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259)) mixed in 0.45 mL water ...
-
bioRxiv - Cell Biology 2022Quote: ... pmTurquoise2-Golgi was a gift from Dorus Gadella (Addgene plasmid # 36 2 05)32 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLenti PGK Puro DEST (w529-2) (hereafter referred to as PGK) (Addgene 19068) and pLenti PGK GFP Puro (w509-5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCas9-Blast (ULK2 sgRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... , (2) nlsLexA::GADfl ORF was amplified from pBPnlsLexA::GADflUw (Gerald Rubin54, Addgene-26232), and (3 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Pmyo-2::mCherry co-injection marker (2.5 ng/μl; pCFJ90, Addgene #19327) were micro-injected in the gonad of young adults ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCRISPRv.2-hygro (Addgene 98291) ...
-
bioRxiv - Cell Biology 2022Quote: ... Number of pulses: 2×106 cells were transfected with ING2-PHD_GFP (Addgene, #21589) or pCSDEST2_NLS-GFP (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT Δ(2-15)-3F pCW57.1 was generated using the pCW57.1 (Addgene, #41393) plasmid backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... 2×106 cells were transfected with 5ug pCBA-I-SceI plasmid (Addgene #26477), 40nmol siRNA and 1ug Cerulean-c1 plasmid (Addgene #54604 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and pLVX-EF1alpha-SARS-CoV-2-Nsp2-2XStrep-IRES-Puro plasmid (Addgene, 141368) were obtained from Addgene ...
-
bioRxiv - Neuroscience 2022Quote: (2) Chronic Window Implantation and Sparse Labeling: Viral vectors were purchased from Addgene. For viral injections and chronic window implantation ...
-
bioRxiv - Neuroscience 2022Quote: The AAV-2 ITR containing plasmids pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (Addgene plasmid #104495 ...
-
bioRxiv - Neuroscience 2022Quote: ... ssAAV-retro/2-hEF1α-iCre-WPRE-bGHp (constructed by the VVF, Addgene #24593) was injected into the DMS (AP:+0.5mm ...
-
bioRxiv - Neuroscience 2022Quote: ... ssAAV-retro/2-hEF1α-iCre-WPRE-bGHp (constructed by the VVF, Addgene #24593) was injected into the DMS (AP:+0.5mm ...
-
bioRxiv - Immunology 2022Quote: ... The replacement was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and one guide RNA that targeted the mouse Vκ3-7 segment ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150; http://n2t.net/addgene:49150; RRID:Addgene 49150) DNA was used to label the ER ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ...
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259) mixed in 0.45 mL water ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 μg of VSV-G envelope expressing plasmid (pMD2.G, Addgene #12259), and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G ...
-
bioRxiv - Genomics 2023Quote: ... and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178). In this study we also used our Essential/Safe-havens library described above.
-
bioRxiv - Biochemistry 2023Quote: ... PDZ2 or PDZ1+2 tandem were obtained from Addgene (Tonikian et al., 2008) or purchased from GeneScript respectively and transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175, https://www.addgene.org/42175/; RRID:Addgene_42175) as template and the HA-coding sequence was included in one of the primer to generate a C-terminally HA-tagged IGF2BP2 ...
-
bioRxiv - Genetics 2023Quote: ... 2 X 106 cells were co-transfected with 10 µg pT077 (Addgene 137879), 1.5 µg AAVS1 TALEN L (Addgene 59025 ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
bioRxiv - Genomics 2022Quote: ... Snai1 and Srebf2 to the pINDUCER21 Dox-inducible lentiviral vector (Meerbrey et al. 2011) using the services of Genscript (Addgene #46948, Supplementary Figures 6 and 7). We used the pINDUCER21 system since it allows us to control the level of over-expression of a gene with precision by adding different levels of Doxycycline to the cell growth media ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Cancer Biology 2019Quote: ... HCT116-Dnmt1Δ3-5 cells were transfected with pcDNA3 vector containing WT full length DNMT1 (36939, AddGene) and empty pcDNA3 vector as a transfection control (10792 ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Cancer Biology 2023Quote: The sgRNAs specific for 5’ to the region of interest were cloned in pLentiCRISPRv2 (Addgene, #52961). sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene ...