Labshake search
Citations for Addgene :
851 - 900 of 1046 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Genetics 2023Quote: ... the FKBP coding sequence was amplified from the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5.CaMKII.tdTomato (Neurophotonics, 661-aav5) was used to label excitatory neurons and AAV9.CaMKII.GCaMP6s.WPRE.SV40 (Addgene, 107790) was employed to image excitatory neuronal calcium activity ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:Addgene_20297) or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860; http://n2t.net/addgene:55860; RRID:Addgene_55860). Matrix-roGFP (mt-roGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the first 639 bp of the 5’ end of p65HSF1 from pAC1393-pmax-NLSPUFa_p65HSF1 (Addgene, #71897). These were then Gibson assembled along with an IDT gBlock containing the last 300 bp of p65HSF1 that had been codon optimised for expression level detection distinct from endogenous mRNA ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Cell Biology 2023Quote: ... and the sgRNA cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmids were named pGGG-ZIP4-B2 Construct 1 (containing sgRNA 4 and 12 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti-ATF4-uORF-GFP reporter plasmid was generated by placing the ATF4 5’UTR from Addgene plasmid #21850 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNAs targeting PCNA exon 5 (PCNAex5_gRNA_1: ATACGTGCAAATTCACCAGA; PCNAex5_gRNA_2: GCAAGTGGAGAACTTGGAAA) were cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). Double-stranded donor plasmids containing the K164R coding mutation (c.491 A>G ...
-
bioRxiv - Neuroscience 2024Quote: ... a volume of 200 nL AAV2/5.hsyn.GcaMP6f.WPRE.SV40 virus or AAV2/5.syn.jGCaMP8s.WPRE (respectively: titer: 1.3*1012 gc/mL; a gift from Douglas Kim & GENIE Project: Addgene viral prep # 100837-AAV5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cloned 5’ to 2xeGFP or 2xmCherry amplified from pHsp83-NLS-HA-2xPCP-2xGFP vector (Addgene #71243) (Halstead et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... pENTR BRAF and pENTR BRAFV600E were gifts from Craig Ceol and pLenti CMV/TO Neo DEST (685-3) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17292). To generate pLenti CMV/TO NRASQ61R Neo we performed Gateway cloning to insert NRASQ61R from the donor vector pDONR223 NRASQ61R into the destination vector pLenti CMV/TO Neo Dest ...
-
bioRxiv - Cell Biology 2022Quote: ... sequence 5’-AGC GGC ATG AAG CAC TCA AT-3’ targeting the last coding exon of Fn1 was subcloned downstream the U6 promoter into the PX459 vector (Addgene, cat # 62988) encoding the Cas9-2A-Puromycin cassette (Ran et al. ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Developmental Biology 2021Quote: We grew HEK293T cells in 10-cm dishes to a confluence of 80% before we transfected the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we infected H9c2s with shRNA against RORα or scrambled shRNA for 48hrs then transfected with an EGFP-Cav-3 plasmid (Addgene plasmid #68396) or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931 ...
-
bioRxiv - Cell Biology 2020Quote: ... targeting KIF4A sequence 5’-GCAAGATCCTGAAAGAGAT-3’ was generated using a multipurpose GATEWAY-based lentiviral tetracycline-regulated conditional RNAi system (GLTR) using pENTR-THT-III (Addgene plasmid #55791) and pGLTR-X-Puro (Addgene plasmid #58246 ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent 2kb 5’ and 3’ homology regions were cloned into pHD-DsRed-attP (gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 51019, RRID:Addgene_51019) 5’ region via EcoRI/NotI ...
-
bioRxiv - Genomics 2020Quote: ... the 3×Flag-BUD13-6HIS fragment was transferred into the pLJM1 lentiviral construct using the NdeI and EcoRI sites (Addgene plasmid # 19319). We produced lentiviruses via co-transfection of pCMV-d8.91 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and non-targeting sgRNA controls (SCR; supplementary table 3) flanked with BsmBI overhangs were ligated into the vector FgH1tUTG-GFP (Addgene Plasmid #70183) using 1uL BsmBI (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: miR-30a-chimeric hairpins for miR-329 and miR-495 stable overexpression were generated via polynucleotide cloning into the 3’ UTR of eGFP in pAAV-hSyn-EGFP vector (Addgene Plasmid #114213) using BsrGI and HindIII sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... was either mutagenized in a 3 kb cloning plasmid (pKSPS (Bahri et al., 2021)) before subcloning into pQCXIB (the retroviral expression vector, Addgene plasmid #22800) or was directly mutagenized in pQCXIB ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Developmental Biology 2023Quote: ... were transfected with 3 μg targeting vector pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro (kind gift from Timo Otonkoski; Addgene plasmid #89992) and 3 μg of PX459 plasmid (kind gift from Feng Zhang ...
-
bioRxiv - Genomics 2022Quote: ... the genome-wide CRISPR-Cas9/KO Toronto Knockout version 3 library from Hart and team (Hart et al., 2017) (Addgene no. 90294), cloned into the 1 vector system (lentiCRISPRv2 carrying Cas9 and sgRNA expression on the same vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA) ...
-
bioRxiv - Neuroscience 2023Quote: ... 150nl of AAV2-hSyn-DIO-hM3D(Gq)-mcherry or 150-600nl of AAV2-hSyn-DIO-mCherry (3×1012 vg/ml, 5.1×1012 vg/ml and 5.6×1012 vg/ml, respectively; Addgene and UNC Vector Core) into the MeA of Foxp2cre+/- mice ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we designed a construct for the first tier of the dCas9-based cascade that is expressed from the EF1α promoter and contains a SapI-flanked cloning site in the 3’UTR for adding a gRNA to target a downstream target: “EF1a-Triplex-28-M13-28-pA” (Addgene ID 202041). Detailed protocols for modifying all of these constructs are provided on the Addgene website.
-
bioRxiv - Neuroscience 2024Quote: ... Gi DREADD virus (n=25,13 males, 12 females: AAV8-hSyn-DIO-hM4Di-mCherry,≥ 1×101 3 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express inhibitory designer receptors in VP GABA neurons ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... WTC-11 iPSCs were electroporated with the corresponding homology plasmid (3 µg per electroporation) and two TALEN plasmids (0.75 µg per electroporation each) targeting the AAVS1 locus (Addgene, #52341 and #52342). iPSCs were dissociated into a single cell suspension ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... For the Tg(fliEP:loxRFPlox:DNtal) construct the 5’ entry clone 478 p5Efli1ep was a gift from Nathan Lawson (Addgene plasmid # 31160 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (serotype AAV1, viral titer ≥ 5×1012 vg/mL; Addgene, Watertown, MA, USA), pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...