Labshake search
Citations for Addgene :
851 - 900 of 1029 citations for 4 2 Trimethylsilyl Ethyl Aniline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Plasmids encoding spikes of SARS-CoV-2 variants Delta (Cat. No. 172320) and Omicron (Cat. No. 179907) were procured from Addgene, USA.
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Genomics 2022Quote: The PCR product was cloned into the pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 vector (Addgene #6125554) using HindIII and XbaI restriction sites ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... Short hairpin RNAs (shRNAs) targeting WSB2 or BCL-2 family proteins were subcloned into the pLKO.1 puro vector (Addgene) for gene KD ...
-
bioRxiv - Microbiology 2024Quote: ... A549 cells were transfected with 2 µg DNA of ARF1-GFP48 (ARF1-GFP was a gift from Paul Melancon, Addgene plasmid #39554 ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transiently co-transfected for 24 h with plasmids for expression of full-length, N-terminal tagged (Flag, HA or tandem Strep tag) BRSK1/2 (or Cys-Ala mutants) and EGFP-TAU (Addgene), using 3:1 polyethylenimine (average Mw ...
-
bioRxiv - Cancer Biology 2024Quote: ... with the plasmid of interest (POI) and two plasmids encoding packaging proteins for viral vector (pAX.2 Addgene Plasmid #35002), pMD2.G Addgene Plasmid #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... targeting two regions of ATP5I’s cDNA (sgATP51 #1 and sgATP5I #2) and one RNA guide targeting GFP (sgGFP) sequence were subcloned into BsmBI restriction site of lentiCRISPRv2 plasmid (#52961, Addgene). For re-expression of ATP5I in control (sgGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... two suitable sgRNA targeting ICL - exon 2 were designed using CRISPOR (Concordet and Haeussler, 2018) and cloned in pDGE Shuttle vectors (Addgene plasmid #153241 pDGE332 and Addgene plasmid #153243 pDGE334 ...
-
bioRxiv - Immunology 2024Quote: ... lentiviral particles were produced by co-transfection of 2 × 106 293T cells with 5 μg of LentiCRISPRv2GFP plasmid (Addgene # 82416) expressing the gRNA targeting the gene of interest or non-targeting control (CTRL ...
-
bioRxiv - Neuroscience 2024Quote: ... or 2 μg of a dominant-negative PAK1 plasmid (pCMV6M-PAK1 H83L H86L K299R, Addgene plasmid # 26592 by Jonathan Chernoff). This transfection was maintained for two days ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer: 2 × 1012 virus molecules/ml) and placed a second microinjection of 200 nl of AAV8-hSyn-DIO-mCherry (Addgene, Catalog#50459-AAV8 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-hSyn-GCaMP6f-P2A-nls-dTomato virus (titer 2 × 1013 GC/mL) that co-expresses GCaMP and nucleus-localized static tdTomato signals was purchased from Addgene, which was a gift from Jonathan Ting (Addgene viral prep #51085-AAV1 ...
-
bioRxiv - Molecular Biology 2024Quote: We transfected HAP1 cells with 2 µg of pX330 U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230; (Cong et al, 2013)) containing LAD-specific or AVVS1-specific guide RNAs ...
-
bioRxiv - Plant Biology 2024Quote: ... the BlpR cassette was replaced by a hygromycin resistance gene under control of the switchgrass polyubiquitin 2 promoter and the 35S terminator derived from plasmid JD633 (Addgene no ...
-
bioRxiv - Neuroscience 2024Quote: ... (2) PV-Cre mice were injected with Cre-dependent retrograde AAVrg-hSyn-DIO-EGFP (1.4E13 GC/ml, Addgene, #50457-AAVrg) or AAVrg-FLEX-tdTomato (1.2E13 GC/ml ...
-
bioRxiv - Biophysics 2024Quote: ... The cloning of 2×Cox8-mGold-HaloTag was synthesized by Tsingke Biotech (Beijing, China) by referencing mEmerald-Mito-7 (plasmid 54160, Addgene) using seamless cloning.
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... two guideRNAs were designed to flank the target exon coding the β1-2 loop (see Table EV1 for primer sequences) and cloned into the guide RNA expression pCFD4 vector (Addgene #49411). The exon of interest and homology arms were cloned into donor template plasmid pHD-ScarlessDsRed (Addgene # 64703 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Molecular Biology 2021Quote: ... four different gRNA sequences (see Table 2 for sequences; Fig. S3A) were multiplexed into a Cas9-nickase backbone (Addgene plasmid 48140) as previously described [64] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) with 8xHis tag was obtained from Addgene (#145145). The mammalian expression vector for soluble ACE2 pcDNA3-sACE2 (WT)-sfGFP (#145171 ...
-
bioRxiv - Cancer Biology 2020Quote: V7 and V8 barcoding lentiviral transfer plasmids used for guide RNA array screening were constructed in 2-part Gibson assemblies using pLJM1-EGFP (Addgene #19319)53 backbone digested with EcoRI + gene blocks for V7 or V8 barcodes to make pLJM1-EGFP-V7 and pLJM1-EGFP-V8.
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses made from pLentiCRISPRv.2 were produced by co-transfection of the lentiviral backbone constructs and packaging plasmids pSPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Biochemistry 2021Quote: Spike display plasmids incorporate the pre-fusion stabilized SARS-CoV-2 S-6P (“HexaPro”) as the reference sequence for all spike variants (Addgene #154754)38 ...
-
bioRxiv - Bioengineering 2021Quote: ... by introducing 75 nt of the SARS-CoV-2 Leader sequence into the NheI-digested EFS-EGFPd2PEST-2A-Hygro plasmid (Addgene 138152). We inserted the TRS-Leader immediately before the coding sequence by ligation of annealed oligos (see Supplementary Table 3 for sequences) ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transfection for the CD63 overexpression construct was done as described above for siRNA transfection using 2 µg/mL of CD63-pEGFP (Addgene, USA) added for 5 h in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... Prime editor 2 was expressed from pCMV-PE2 and pegRNAs from pU6-pegRNA-GG-acceptor plasmids30 (Addgene #132775 and #132777, respectively). Plasmid transfection was performed using FuGENE HD (Promega ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses made from pLentiCRISPRv.2 were produced by co-transfection of the lentiviral backbone constructs and packaging plasmids pSPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Molecular Biology 2022Quote: PegRNAs-expressing plasmids (pU6-pegRNA) were cloned by ligating annealed oligo pairs (Supplemental table 2) with BsaI-digested pU6-peg-GG-acceptor (Addgene #132777) as described previously (Anzalone et al. ...
-
bioRxiv - Cancer Biology 2022Quote: MIA PaCa-2 wild type (WT) and TSC1/TSC2 knockout (KO) cells were transduced with retrovirus expressing RFP (pQCXIP-turboRFP, Addgene #73016) or EGFP (pQCXIP-EGFP-F ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Immunology 2020Quote: ... and upstream of VH81-X (downstream of VH2-2) (Cut2) were cloned by annealing pairs of oligos into pX459 with a puromycin selection marker (Addgene, #62988) following the standard protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Microbiology 2021Quote: The lentiviral sgRNAeBAR-expressing backbone was constructed by inserting sgRNA scaffold embedded MS2 loops at tetraloop and stemloop 2 along with eBAR sequence into pLenti-sgRNA-Lib (Addgene, 53121). The sgRNA-expressing sequences were cloned into the backbone using the BsmBI-mediated Golden Gate cloning strategy (47) ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Genomics 2020Quote: ... 10 human non-targeting sgRNAs and 10 mouse non-targeting sgRNAs (Supplementary Table 2) were individually synthesized and cloned into the lentiviral transfer vector CROPseq-Guide-Puro3 (Addgene 86708), which leads to the synthesis of an RNA Pol3 transcript of the Cas9 sgRNA and an RNA Pol2 polyadenylated transcript containing the puromycin resistance gene ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...