Labshake search
Citations for Addgene :
851 - 900 of 2473 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Neuroscience 2024Quote: ... -2.2 mm ventral from skull under an angle of 10°) and injected with AAV5-hSyn-DIO-mCherry (3*10^12 gc/ml; 300nl; Addgene) in LHA (-1.3 mm posterior to bregma ...
-
bioRxiv - Cell Biology 2024Quote: The monoclonal SK-N-DZ SCLYKO cell line was transduced with Toronto KnockOut (TKO) CRISPR Library - Version 3 (Addgene, 90294) at MOI of 0.3 ...
-
bioRxiv - Molecular Biology 2024Quote: We cloned two previously published gRNA sequences (13) targeting 5’ or 3’ of the SCR into a Cas9 expressing px330 backbone (#158973, Addgene) according to the protocol published by the Zhang lab (38) ...
-
bioRxiv - Molecular Biology 2024Quote: To generate CRISPR/Cas9-mediated knockout lines, the sgRNA targeting TRIM37 (TRIM37Δ, 5′-ctccccaaagtgcacactga-3′) was cloned into the PX459 vector (#62988; Addgene) containing a puromycin resistance cassette ...
-
bioRxiv - Microbiology 2024Quote: ... second transduction was performed 3 days after the addition of puromycin using pLenti SpBsmBI sgRNA Hygro vector (Addgene, Plasmid # 62205) harboring the IMPDH2 sgRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... For the VIP silencing experiments (Figure 7H) 3 VIP-Cre mice were injected with a mixture of viruses expressing GcaMP7f (pGP-AAV9-syn-jGCaMP7f-WPRE, Addgene) and Cre-dependent ArchT (pAAV-FLEX-ArchT-tdTomato (AAV5) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNAi clone that targets the 3’UTR of cdc-42 was generated through amplification of genomic cdc-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Cancer Biology 2024Quote: ... targeting a DNA sequence within the first exon of the FasL gene (5’-CTGGGCACAGAGGTTGGACA-3’) was cloned into the BsmBI restriction site of the 3rd generation LentiCRISPR.V2 (Addgene, #52961) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT, Addgene). Cells were incubated for 48h in a DMEM cultivation medium (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... . The 293 T cells were transfected with pLVX-TFAP2B-3×Flag together with psPAX2 and pMD2.G lentiviral packaging systems (Addgene) to generate TFAP2B stably overexpressed cell lines.
-
bioRxiv - Biochemistry 2024Quote: ... a pooled library of synthetic 3’ UTRs was cloned downstream of eGFP in the pCDNA5/FRT/TO plasmid (Addgene 19444). Each 3’ UTR consisted of a 19-nucleotide fixed spacer ...
-
bioRxiv - Cell Biology 2024Quote: ... HT29 parental cells were transfected with pMA-T-gRNA-RIP1-3 (synthetic construct expressing the guide) targeting RIPK1 and Cas9-GFP (pSpCas9(BB)-2A-GFP (PX458, Addgene). The Cas9-target sites are ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... Snai1 and Srebf2 to the pINDUCER21 Dox-inducible lentiviral vector (Meerbrey et al. 2011) using the services of Genscript (Addgene #46948, Supplementary Figures 6 and 7). We used the pINDUCER21 system since it allows us to control the level of over-expression of a gene with precision by adding different levels of Doxycycline to the cell growth media ...
-
bioRxiv - Cell Biology 2020Quote: ... pLenti [CM V/GFP/Hygro] (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17446). The cut backbone vector was treated with Antarctic Phosphatase (cat# M0289S ...
-
bioRxiv - Neuroscience 2021Quote: ... Subset of pups were bilaterally injected with 4 μl AAV9-hsyn-EGFP (3.4×10^13 gc/ml, Addgene) or 4 μl ACh3.0 (1.8×10^13 gc/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446; http://n2t.net/addgene:17446; RRID:Addgene_17446)65 ...
-
bioRxiv - Biochemistry 2022Quote: HEK293T cells were transiently transfected with pGP-CMV-GcAMP6s (Ca2+ Sensor plasmid, Addgene, Cat. no. 40753; 4 µg), 5HT2c receptor (as positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and subcloned into pLenti-CMV-GFP-Hygro (656-4) (gifted from Eric Campeau & Paul Kaufman; Addgene plasmid # 17446) using NEBuilder® HiFi DNA Assembly Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: The genome-wide Brie CRISPR-KO library (4 sgRNAs per gene; ~ 80.000 sgRNAs) was purchased from Addgene (#73632) and amplified according to the supplier’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection was performed with control vector (pcDNA/GW-40/LacZ) or 4 μg pARID1A (Addgene catalogue number 39311) using FuGENE 6 Transfection Reagent (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent BW25113 cells were co-transformed with the pORTMAGE-4 plasmid (Addgene plasmid #72679, courtesy of Csaba Pál) and the pBAD-yTrm5 plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasmid DNA (5 ng/μl) and Tol2 transposase mRNA(4 ng/μl) (synthesized from pT3TS-Tol2 Addgene #31831) were injected into one-cell stage embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Neuroscience 2022Quote: ... Pups were injected bilaterally with 4 ul of AAV9-hSyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene). Mice also received an injection of AAV9-hSyn-GRABACh3.0 to express the genetically encoded cholinergic sensor GRABACh3.0 48 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4×105 HEK 293T cells were transfected with pCDH-EF1-sCTLA-4 expression plasmid (1.5 µg) and psPax2 (2 µg) and pMD2.G (1.5 µg) packaging plasmids (Addgene), using Viafect™ (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Cell Biology 2023Quote: We synthesized gRNAs flanking exon 4 and 5 and cloned them into the gRNA cloning vector (Addgene # 41824) using Gibson assembly (New England Biolabs)[19] ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259), 10 µg of psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Neuroscience 2024Quote: The pAAV-hSyn-DIO-hM4D(Gi)-mCherry (DREADD virus) (4*10^12 gc/ml, Addgene, United States, addgene.org) or pAAV-hSyn-DIO-mCherry (4.2*10^12 gc/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
bioRxiv - Neuroscience 2021Quote: ... DJ-1 (pGEX-5X-1-DJ1-WT; Addgene) or pcDNA plus RFP plasmid(57 ...
-
bioRxiv - Cancer Biology 2021Quote: Indicated cell lines were transfected using lipofectamine 3000 with 3 µg of p65 reporter plasmid (pHAGE NF-κB-TA-LUC-UBC-GFP-W plasmid from Addgene #49343). After 48h ...
-
bioRxiv - Cell Biology 2020Quote: ... A template vector which carries full-length AID-3 × FLAG-P2A-BSD was produced with the backbone of pMK392 (Addgene, 121193). Full-length AID-3×FLAG-P2A-BSD was integrated into the site just before the terminal codon of the sub-cloned CENP-E gene ...
-
bioRxiv - Genetics 2021Quote: mks-3::gfp transgenes were generated with PCR-based fusion of mks-3 gDNA (including 485 bp of 5’ UTR sequence) with GFP (pPD95_77, gift from Andrew Fire, Addgene plasmid #1495). All primers are listed in Table S4 ...
-
bioRxiv - Genetics 2021Quote: ... hermaphrodites were injected with 0.25ng/μl mks-3::gfp and 100ng/μl coel::dsRed (gift from Piali Sengupta, Addgene plasmid #8938) to generate extrachromosomal arrays (1-7 lines each) ...
-
bioRxiv - Genetics 2020Quote: Flies expressing a gRNA targeting the rosy (ry) locus (5’-CATTGTGGCGGAGATCTCGA-3’) were generated by cloning the gRNA sequence into the pCFD3 plasmid (Addgene #49410) as in [44] ...
-
bioRxiv - Developmental Biology 2020Quote: The LV-MiniP-H2B-GFP vectors were prepared by inserting the respective MimiP sequences (24) into the LV-H2B-GFP vector (3) (Addgene, #25999) using PCR introduced SalI ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the generation of the double K73E K80E (2KE) sov mutant two guides (Supplementary Table 3) were cloned into pDCC6 (Addgene 59985) and co-injected with an AltR HDR donor oligo (IDT ...
-
bioRxiv - Genomics 2020Quote: ... The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table. The INTS6 PCR product and MSCVpuro vector (Addgene 68469) were digested with XhoI (NEB R0146 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’–CACCTTTGCCACTCTCAAAGGGGA-3’ and sgRNA REV: 5’-AAACTCCCCTTTGAGAGTGGCAAA-3’) was cloned into a BbsI digested pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (42230; Addgene, Cambridge MA). Template DNA for in vitro transcription was generated by PCR amplification of the gRNA sequence—which included both the guide sequence as well as the scaffold sequence encoded in the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid—using Phusion HF DNA polymerase and a primer set (synthesized by IDT ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Cell Biology 2021Quote: ... The UAS sites and K10 3’UTR were replaced via PCR with the squash promoter and squash 3’UTR from pBS-Squ-mCherry (Eric Wieschaus56, Addgene 20163). The RhoGEF2 ORF was obtained from the DGRC (SD04476) ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting exon 3 of the Prnp gene (5′-TCA GTC ATC ATG GCG AAC CT −3′) was cloned into the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene 50946,) to generate pKLV-Prnp sgRNA plasmid ...