Labshake search
Citations for Addgene :
801 - 850 of 984 citations for Recombinant Human ERBB2 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Toronto human knockout pooled library (TKOv3) containing 71,090 based on a lentiCRISPRv2 backbone was a gift from Jason Moffat (Addgene #90294). The library was transformed and amplified using 25 μl Endura Competent Cells (Lucigen ...
-
bioRxiv - Genetics 2020Quote: Two pairs of gRNAs (Table S1 in “Supplementary file”) intermediated by human U6 (hU6) promoter were cloned after hU6 promoter of the plentiCRISPR_V2 plasmid (Addgene, #52961), according to Vidigal et al.’s protocol 34 ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a plasmid expressing human Ago2 fused to GFP in the N-terminal region of Ago2 was obtained from Addgene (11590). For recombinant protein purification ...
-
bioRxiv - Neuroscience 2022Quote: ... and fused in frame without a linker to human H2B (H2BC11) (accession #NM_021058) and cloned into the pAAV-CAG-tdTomato (Addgene #59462) using the sites KpnI and EcoRI at the 5 and 3 prime end respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV8 encoding the inhibitory designer receptor KORD fused to the fluorescent protein mCitrine under the control of the human synapsin promoter in a Cre-dependent manner was obtained from Addgene (AAV8-hSyn-dF-HA-KORD-IRES-mCitrine ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Microbiology 2022Quote: ... The Jun-Nt VFP (Jun) and Fos-Ct VFP (Fos) and the human ACE2 and TMPRSS2 expressing plasmids were obtained from Addgene (#22012 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2022Quote: Full length human TAOK1 was obtained from Transomics Technologies in PCR-XL-Topo plasmid and inserted into sfGFP-C1 (Plasmid #54579, Addgene), using the EcoRI and MfeI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genetics 2024Quote: The IS621 recombinase gene was human codon optimized and cloned into a modified pFastBac expression vector (Addgene, Item ID: 30115), which includes an N-terminal His6-tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Cell Biology 2023Quote: A plasmid for expression of full-length human KIF1C (pKIF1C-GFP) was a gift from Anne Straube (Addgene plasmid #130977107). All truncated versions of KIF1C (see Resource Table) ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... The the AAV carrying the plasmid coding for iGluSnFR under the human synapsin promoter (pAAV.hSyn.iGluSnFR.WPRE.SV40) was a generous gift from Laren Looger (Addgene viral prep # 98929-AAV9) or produced in our own laboratory ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentiviruses with this construct were produced by transfecting human embryonic kidney 293T (HEK 293T) cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... human EZH2 wildtype and the K20R or S21A mutant of human EZH2 were cloned into the retroviral pMSCV-Puro vector containing 3xFlag-3xHA epitope (Addgene) and the recombinant retroviruses were packaged in 293 cells (Guo et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... CAFs were immortalized with stable expression of human telomerase reverse transcriptase (pBABE-neo-hTERT was a gift from Bob Weinberg (Addgene plasmid # 1774 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TGTCAGGGGACAGCAGGGGA and AGCAGAGGGTGCGGTGGAAA of the human GHRHR gene (ENSG00000106128) were cloned into the lenti-sgRNA (MS2) puro backbone vector (73795, Addgene). Lentiviral particles were generated by transient co-transfection with the pMD2.G (12259 ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Immunology 2023Quote: ... MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Microbiology 2022Quote: ... sequences targeting human SFPQ were designed using the CRISPOR tool (http://crispor.tefor.net) and cloned into pX459-V2 vector (Addgene Plasmid #62988). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Human foreskin fibroblasts (HFF, SCRC- 1041, ATCC) were immortalized using a human telomerase-expressing retrovirus (pWZL-Blast- Flag-HA-hTERT, 22396, Addgene).
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Genetics 2023Quote: Two sgRNA oligonucleotide probes targeting different sites in human PIF1 and RAD52 or non-target were cloned into lentiCRISPRv2 puro (Addgene). Plasmids that contain each sgRNA were transfected to HEK293T cells using Lenti-X packaging single shots (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible inhibitory designer receptor human M4 muscarinic receptor (hM4DGi; AAV2-Syn-DIO-hM4Di-mCherry; Addgene) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: Cortical expression of the calcium sensor GCaMP7c was attained via focal viral injection of AAV1 under the human synapsin (hsyn) promoter for broad neuronal expression (#105321, Addgene).41 CD-1 male mice (P42-56 ...
-
bioRxiv - Microbiology 2023Quote: Human and cat ACE2 expressing lentiviral plasmids (pscALPS-hACE2 and pscALPS-cACE2) were obtained from Addgene (158081 and 158082, respectively). Each gene was tagged with a c-terminal Myc-tag epitope to facilitate detection ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... The Scrib-Flag plasmid was generated by amplifying human Scrib coding sequence from MSCV Puro SCRIB WT (Addgene, Cat# 88886) and fused with 3xFlag tag at the C-terminal in pcDNA3 backbone ...
-
bioRxiv - Neuroscience 2024Quote: ... were cloned by PCR amplification of human LGals3 and LGals8 cDNAs from the pHAGE-mKeima-LGALS3 and pHAGE-FLAG-APEX2-LGALS8 plasmids (Addgene plasmids #175780 and #175758 ...
-
bioRxiv - Cancer Biology 2024Quote: Murine KSR1 (resistant to degradation by sgRNA sequences targeting human KSR1) was cloned into MSCV-IRES-KSR1-RFP (Addgene #33337) and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene #8449 ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Microbiology 2024Quote: ... annealing to exon 4 of the ORF of the human BST2 gene was designed and cloned into lentiCRISPR v2 (Addgene). Next ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid YFP-SRI was generated by sub-cloning human sorcin cDNA taken from pAd-hSRI (22) into KpnI-ApaI sites of mVenusC1 (Addgene #27794).
-
bioRxiv - Molecular Biology 2020Quote: FLAG-mEm-WT Tau and FLAG-mEm-Tau K174Q sequences were cloned into pAAV2 vector under human synapsin promoter (Addgene, #50465). Adenoviral particles were used to infect a primary hippocampal culture.
-
bioRxiv - Molecular Biology 2021Quote: ... similar to how we previously generated the human cell expression constructs for AcrIIA4 and AcrIIA5 (Addgene IDs 133801 and 133802, respectively) (see Supplementary Sequences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Genetics 2019Quote: sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2: GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA was cloned into the p3xFLAG CMV26 (C-terminal ...