Labshake search
Citations for Addgene :
801 - 850 of 889 citations for Recombinant Human BACE1 None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... REEP1-mEmerald and REEP1-mCherry plasmids were generated by inserting a codon-optimized human REEP1 gblock into mEmerald-N1 (gift from M. Davidson; Addgene #53976) or mCherry-N1 backbones (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Synapsin1 promoter and smFP-HA were PCR amplified from pAAV-hSyn-EGFP (a gift from Bryan Roth, Addgene Plasmid #50465) and pCAG_smFP-HA (a gift from Loren Looger ...
-
bioRxiv - Microbiology 2022Quote: To make human ACE2 protein, pcDNA3-sACE2-WT(732)-IgG1 (Chan et al., 2020) (Addgene plasmid #154104, gift of Erik Procko) plasmid was transfected into Expi293 cells using PEI at a ratio of 1:3 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent mCherry under the human synapsin promoter in dHPC (AAV5-hSyn-DIO-mCherry, titer: 1.1 × 1013 vg/ml, Catalog #50459-AAV5, Addgene, Watertown, USA). For optogenetic experiments ...
-
bioRxiv - Biochemistry 2023Quote: ... Human ATAD2B bromodomain-containing protein (residues 953−1085, Uniprot code: Q9ULI0) was a gift from Nicole Burgess-Brown (Addgene plasmid # 39046) was PCR-amplified and cloned into pDEST15 (GlaxoSmithKline ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Cancer Biology 2023Quote: ... the double-stranded oligonucleotide sgRNAs for human FOXM1 sequences were ligated into the BbsI sites of the FgH1tUTG plasmid (Addgene, #70183). sgRNA target sequences were listed in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence) ...
-
bioRxiv - Cancer Biology 2022Quote: ... A MYC T58A gene (synthesized by IDT, Coralville, USA, using the human MYC T58A sequence as template from Addgene plasmid # 18773) [69] ...
-
bioRxiv - Cell Biology 2023Quote: The DNA fragment encoding human integrin β5 was amplified from the pCX-EGFP beta5 integrin receptor (a gift from Raymond Birge, Addgene #14996), and then inserted into the pEGFP-N1 vector (Clontech ...
-
bioRxiv - Developmental Biology 2023Quote: An enhanced piggyBac Puromycin selectable and DOX inducible vector was digested with EcoRI-NotI and ligated with PCR-amplified human SOX2 from the FUW-tetO-hSOX2 plasmid (Addgene#20724). Transfection into hPSCs was done using Lipofectamine Stem Reagent per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The transgene was constructed using the Gateway recombination system to introduce the Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into the pHAGE-TRE-DEST-NBioTAP (Addgene #53568) lentiviral vector ...
-
bioRxiv - Cell Biology 2023Quote: The EGFP-tr53BP1 construct was assembled using Gibson Assembly with a fragment of human 53BP1 (amino acids 1221-1709, Addgene #69531) (4 ...
-
bioRxiv - Cell Biology 2023Quote: ... One sgRNA was cloned into pMCB320 as detailed above (see “Generation of Single Knockout Cell Lines with sgRNAs from the Bassik Human CRISPR/Cas9 Deletion Library”) while a second sgRNA was cloned into pKHH030 (Addgene #89358). To clone a sgRNA into pKHH030 ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids constructs pSBbi-RN-FGF19 and pSBbi-BB-FGF15 were respectively generated by cloning the human FGF19 amplified from Huh7 cDNA and the mice Fgf15 amplified from ileum cDNA onto the pSBbi-RN (Addgene #60519) and pSBbi-BB (Addgene #60521 ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of the extracellular region of human TfR1 (residues 89–760) were amplified by PCR and inserted into pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) with EcoRV and XbaI sites ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) 19 ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... cells were infected with a lentiviral pool of the Human Brunello CRISPR knockout pooled library (a gift from David Root and John Doench: Addgene #73178) at an MOI of 0.3 and with a coverage of 500 cells per sgRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Immunology 2023Quote: DNA comprised of the human HDAC2 gene with flanking BglII and BamHI restriction sites was synthesized and cloned into pmVenus (L68V)-mTurquoise2 (AddGene #60493) such that a fusion protein of mVenus-HDAC2-mTurqoise2 was produced ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Cancer Biology 2020Quote: The human CRISPR Brunello lentiviral prep was obtained from the Broad Institute Genetic Perturbation Platform and is also available from Addgene (73179-LV). The library contains 76,441 sgRNAs targeting 19,114 protein-coding genes and 1,000 non-targeting control sgRNAs ...
-
bioRxiv - Biochemistry 2019Quote: The full-length sequence of mouse E1 in pET28a vector (kind gift from David Komander) and human UBE2W in pET15b vector (kind gift from Wade Harper, Addgene plasmid #15809) were coded to include an N-terminal His6-tag to facilitate protein expression ...
-
bioRxiv - Molecular Biology 2019Quote: An N-terminal FLAG tag sequence was appended via Gibson Assembly Cloning (New England Biosciences) to a human codon optimized Cas9 (subcloned from hCas9, a gift from G. Church, Harvard; Addgene plasmid 41815) with a single C-terminal NLS expressed from a pcDNA3.3-TOPO vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Bioengineering 2021Quote: ... and Tspan12 were gifts from Jeremy Nathans and the human ACE2 clone (Shang et al., 2020) was obtained from Addgene (code 145033). Synthetic DNA fragments of engineered VH containing SARS-CoV-2 RBD (resi 333-527 ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene, Cambridge, MA) following the depositor’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... solution carrying the jGCaMP7s gene under the human synapsin promoter (AAV1-hsyn-jGCaMP7s, ~1e12 GC/ml, 50 nl in each injection spot, Addgene plasmid #104487) was injected into the visual ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... a construct encoding a human codon-optimized Cas9 (hCas9) with an NLS at its C-terminus (a gift from George Church, Addgene plasmid #41815) (Mali et al. ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: We used a virus with the Gq-coupled designer receptor exclusively activated by a designer drug (DREADD) attached to the human synapsin promoter and the m-Cherry reporter (DR, AAV2 – hSyn – hM3Dq – mCherry; Addgene, Watertown, MA), as well as an empty vector control virus (Con ...
-
bioRxiv - Neuroscience 2022Quote: ... expressing mRuby2 and GCaMP6s under the human synapsin promoter (pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA) was purchased from Addgene (50942-AAV1). NPCs were differentiated to neural cells as described above and transduced by adding 1.44 μl virus solution per well in a μ-Slide 4 Well 5 days after cell seeding ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Raf1 gRNA sequence derived from a 3rd generation lentiviral gRNA plasmid targeting human Raf1 (A gift from John Doench, David Root, Addgene plasmid #76708). Specifically ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2019Quote: The cell line expressing a DELE1-mClover transgene line from the AAVS1 locus was generated by transfecting a cXG289 population in which ∼ 50% of cells expressed a DELE1-sgRNA and a BFP marker with pXG289 and TALENS targeting the human AAVS1 locus (AAVS1-TALEN_L/R, Addgene #59025 and #59026). Through FACS sorting ...
-
bioRxiv - Molecular Biology 2019Quote: ... The donor plasmid pAAVS1-TRE3G-NGN2 was constructed by replacing EGFP with human NGN2 in plasmid AAVS1-TRE3G-EGFP (Addgene plasmid # 52343). The donor plasmid pAAVS1-TRE3G-NGN2 (5 μg) ...
-
bioRxiv - Cell Biology 2020Quote: Human GeCKOv2 CRISPR knockout pooled library and lenti-Cas9-Blast was a gift from Feng Zhang (Addgene # 1000000049, (Sanjana et al., 2014)) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB (Uniprot Q9Y3I0) was inserted using ligation-independent cloning into the UC Berkeley MacroLab 438B vector (Addgene plasmid #55219) and DDX1 (Uniprot Q92499) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral vectors containing wild type and DNA-binding mutants of PRRX1 were generated by cloning cDNAs encoding full length or homeodomain deletions of the human PRRX1A sequence into the pInducer20 lentiviral plasmid (gift from Stephen Elledge, Addgene plasmid #44012). The DNA-binding mutants harbor individual deletions of the three α-helices (ΔH1 ...
-
bioRxiv - Microbiology 2020Quote: ... Guide sequences for IPPK and IPMK were obtained from the Human GeCKOv2 CRISPR knockout pooled libraries (a gift from Feng Zhang; Addgene #1000000048, #1000000049) [32] ...