Labshake search
Citations for Addgene :
801 - 850 of 1446 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Plant Biology 2024Quote: ... The MoClo Plant Parts Kit was a gift from Nicola Patron (Addgene kit # 1000000047) (Engler et al ...
-
bioRxiv - Neuroscience 2024Quote: ... D1R-Tango was cloned from the PRESTO-Tango GPCR Kit (Addgene kit no. 1000000068), and HaloDA1.0-Tango was generated by replacing D1R in D1R-Tango with HaloDA1.0 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplified and cloned between SalI and XbaI sites of pAV-U6+27 (Addgene, plasmid #25709) to yield pAV-U6+27-RhoBAST2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR-amplified from a previously assembled vector (ppk10779-T2A-QF2-SV40, 3xP3-dsRed, Addgene accession #130667)
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Luc2TdTomato cassette was PCR amplified from the pcDNA3.1(+)/Luc2=TdT plasmid (Addgene, https://www.addgene.org/32904/)9 ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Microbiology 2021Quote: ... the 3xmCherry cassette was PCR amplified from pGGC026 (pGGC026 was a gift from Jan Lohmann (Addgene plasmid # 48831 ...
-
bioRxiv - Microbiology 2020Quote: ... CASP8 ORF was amplified from pcDNA3-CASP8 by PCR (Addgene #11817, a gift from Guy Salvesen) (Stennicke & Salvesen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... by combining a PCR-amplified FNLS-APOBEC1 DNA from pLenti-TRE3G-FNLS-PGK-Puro (Addgene# 110847), PCR-amplified Cas9n-NG DNA from pX330-SpCas9-NG (Addgene# 117919) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we carried out PCR to amplify the mScarlet sequence from the ITPKA-mScarlet plasmid (Addgene, USA) as well as the GRB2 sequence from GRB2-YFP (gift from J ...
-
bioRxiv - Biochemistry 2022Quote: ... and rat TRPM8 were amplified by PCR and subcloned into p3xFLAG-eYFP-CMV-7.1 vector (Addgene) at the NotI/BamHI sites or into 8xHis-MBP pFastBac1 modified with a CMV promoter (obtained from David Julius’ lab ...
-
bioRxiv - Cell Biology 2022Quote: ... The mNeonGreen2 sequence was PCR amplified from pLenti6.2_mNeonGreen2 (a gift from Vanessa LaPointe; Addgene plasmid # 113727) and was inserted in the AscI tagging site using Gibson assembly.
-
bioRxiv - Neuroscience 2020Quote: ... Two guides RNAs were selected and produced by PCR using the pX330 plasmid (Addgene, Watertown, MA) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HaloTag sequence was obtained by PCR from pENTR4-HaloTag (gift from Eric Campeau, Addgene #29644). The donor plasmids for the ΔCTD ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Neuroscience 2021Quote: ... the U6-BbsI/BbsI cassette was PCR amplified from px458 (Addgene #48138, (Ran et al., 2013)) (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... we Gibson assembled a PCR product containing CMV-StrepKDEL-IRES-SBP (amplified from Addgene plasmid #65295) to the SalI/MluI digested piggyback backbone (a generous gift from Jonathon Nixon-Abell ...
-
bioRxiv - Synthetic Biology 2020Quote: ... GEM effector expression cassette together with the LEU2 marker was PCR amplified from pHES83917 (Addgene # 87941) using primers OZL348 and OZL349 and integrated downstream of the YFL033C locus of SZL149 and SZL281 (SZL149+msh2Δ) ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2; Addgene #81084). The acceptor plasmid was cut with NheI (New England BioLabs ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2 Addgene #81084). The acceptor plasmid was cut with NotI (New England BioLabs ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Developmental Biology 2022Quote: LSSmKate2 and mBeRFP were individually amplified by PCR with specific primers from pLSSmKate2-N1 (Addgene #31867) and LK1-MpEF1+mBeRFP+Nos-T35S-T (gift from F ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding EGFP-SV40 PolyA was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding the hL1CAM ORF was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Genomics 2021Quote: ... pLuc2-PromLDLR was created by PCR expansion of the target luciferase from pGL4Luc-RLuc (Addgene 64034), custom gene synthesis of the LDLR promoter (NCBI Reference Sequence NG_009060.1 ...
-
bioRxiv - Genetics 2020Quote: ... The BamHI/ XhoI digested NCL PCR product was cloned into BamHI/ XhoI digested pGPD2 (Addgene; #43972). The NCL-ΔRGG plasmid was similarly created using primers NCL-For and NCLΔRGG-1XHA Rev (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The amplified PCR products were ligated to the NotI and SalI linearized MSCV vector (RRID: Addgene_17442). The MSCV murine ADAR2E396A expression construct was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR-amplified ORF inserts were Gibson assembled into NcoI-HF- and XhoI-digested pET-21a(+) (Addgene) and then transformed into E ...
-
bioRxiv - Cell Biology 2022Quote: ... scFV-HAtag-sfGFP-GBI was PCR-amplified from pHR-scFv-GCN4-sfGFP-GB1-dWPRE (Addgene, #60907) and inserted between the NheI and HindIII sites of the pcDNA-puro vector.
-
bioRxiv - Cell Biology 2022Quote: ... strain MB921 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-Cterm-pFA6a-GFP/paGFP-F and Cut7-Cterm-pFA6a-GFP/paGFP-R ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB1147 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-988-Cterm-pFA6a-GFP-F (TTAAAGGGAACGACATCACTTGCTAATCATACTAATGAATTACTTGGTTTAG-GAGATGAACGGATCCCCGGGTTAATTAA ...
-
bioRxiv - Physiology 2022Quote: ... a DNA block containing sgEGFP-tRNA-Hnf4a-sg2 was PCR-amplified using pGTR plasmid (Addgene #63143) as a template and primers listed in Table S2 (see also Fig ...
-
bioRxiv - Synthetic Biology 2022Quote: ... was cloned by PCR amplifying both the mCherry from LLP469 pEF1a-mCherry-EMPTY-gRNA (Addgene, #100958) and the backbone of αGCN4-p65HSF1-CO ...
-
bioRxiv - Molecular Biology 2023Quote: ... full length BRCA1 was PCR-amplified from pCL-MFG-BRCA1 (Addgene #12341 (Ruffner and Verma, 1997)) with a triple Ty1-tag included in the reverse primer and subsenquently cloned into pENTR_1A and transferred to pCW57.1 using gateway cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... T2A-QF2 including loxP-flanked 3xP3-RFP was PCR amplified from pBPGUw-HACK-QF2 (Addgene #80276), followed by insertion into pTOPO-acj6 right before the stop codon of acj6 by DNA assembly (New England BioLabs #E2621S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The deaminase and UGI components in ciBE4max and ciAncBE4max were PCR-amplified from pCMV_BE4max (Addgene #112093) and pCMV_AncBE4max (Addgene #112094) ...
-
bioRxiv - Cell Biology 2023Quote: ... The NFAST sequence was amplified by PCR from the Addgene plasmid pAG148 FRB-NFAST (Addgene #130812) and ligated at the 3’ of ER-targeting sequence into pcDNA3.
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was further digested using BamHI along with tol2kit 101_p5E-Ubiquitin plasmid (Addgene #27320). Both were purified and 101_p5E-Ubiquitin was dephosphorylated using NEB Antarctic phosphatase following manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... was PCR-amplified from wt-TDP43- tdTomato-HA plasmid (Addgene 28205, a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S ...