Labshake search
Citations for Addgene :
801 - 850 of 855 citations for FabFc ZAP human Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat. # 1000000060) (54).
-
bioRxiv - Cell Biology 2024Quote: ... kit using 3 µg of mouse Septin 12-GFP plasmid (pEGFP-C1, Addgene, USA) and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The BGA polyadenylation signal was amplified from plasmid C7 (MXS Chaining Kit; Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit ...
-
bioRxiv - Synthetic Biology 2019Quote: ... synthetic gene fragments from Integrated DNA Technologies (IDT) and the EcoFlex kit (47) from Addgene.
-
bioRxiv - Synthetic Biology 2021Quote: All remaining plasmids were generated using Goldengate cloning with the MoClo toolkit (Addgene Kit#1000000044) as described in Weber et al ...
-
bioRxiv - Neuroscience 2022Quote: ... Gβ and Gγ-GFP2 constructs were purchased as part of the TRUPATH kit from Addgene.
-
bioRxiv - Systems Biology 2024Quote: ... Gβ3 and Gγ9-GFP2 were purchased as part of the TRUPATH biosensor kit from Addgene. The oligonucleotides for making the GαsE392K-Rluc8 and GαsL388R-Rluc8 mutations were designed using Agilent Technologies’ online primer design tool ...
-
bioRxiv - Molecular Biology 2023Quote: ... cerevisiae Advanced Gateway™ Destination Vectors were a gift from Susan Lindquist (Addgene kit #1000000011).
-
bioRxiv - Neuroscience 2023Quote: ... TALE repeat arrays were assembled using the Joung Lab REAL Assembly TALEN kit (Addgene 1000000017). Synthesized TALEN mRNAs were injected into the cytoplasm of one-cell stage embryos ...
-
bioRxiv - Bioengineering 2020Quote: ... Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned separately into the pHLsec mammalian expression vector (Addgene, #99845) via Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... the antibody component of the SunTag system (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS45, a gift from Ron Vale, Addgene #60904) was digested with EcoRI+NotI and subcloned into the blunted BamHi site of pCW-TRE ...
-
bioRxiv - Bioengineering 2023Quote: ... To generate the monoclonal IgG1 antibody CSL362 biosimilar MIRG123 the VH and VKL sequences were cloned into AbVec2.0-IGHG1 (Addgene plasmid # 80795) and AbVec1.1-IGKC (Addgene plasmid # 80796) ...
-
bioRxiv - Bioengineering 2024Quote: Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned individually into the pHLsec mammalian expression vector (Addgene, #99845) using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and terminator parts used in the constructs described were provided by Douglas Densmore (Addgene kit 1000000059).
-
bioRxiv - Biophysics 2020Quote: We assembled TALE-TF with the Golden Gate TALEN and TAL Effector Kit2.0 (Addgene kit #1000000024) 101 as previously described 23 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit; Addgene reference #62421).
-
bioRxiv - Biochemistry 2022Quote: ... The Saccharomyces cerevisiae Advanced Gateway Destination Vector Kit was purchased from Addgene (Watertown, MA, United States). Phusion high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Bioengineering 2022Quote: ... This plasmid was then used as a template for Golden Gate-based cloning (MoClo Plant Kit, Addgene) (47) ...
-
bioRxiv - Plant Biology 2024Quote: Designer TALEs were constructed using the Golden Gate TALEN and TALE Kit 2.0 (Addgene, Watertown, MA, USA) according to the manufacturer’s protocol79 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Neuroscience 2020Quote: We employed a two-step Golden Gate assembly method using the Platinum Gate TALEN Kit (Addgene; cat#1000000043) to construct Platinum TALEN plasmids containing the homodimer-type FokI nuclease domain ...
-
bioRxiv - Molecular Biology 2021Quote: ... the inserts from the entry clones were subcloned into pAG413GAL-ccdB and pAG416GAL-ccdB vectors (Addgene kit #1000000011) [31] by LR Gateway reaction (Invitrogen™) ...
-
Reconstitution of prospermatogonial specification in vitro from human induced pluripotent stem cellsbioRxiv - Developmental Biology 2020Quote: ... TALEN constructs targeting DDX4 were generated using a Golden Gate TALEN and TAL Effector kit 2.0 (Addgene, #1000000024)69 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The annealed oligo products were directionally cloned into the Addgene Multiplex CRISPR/Cas9 Assembly Kit (Addgene, Watertown, MA) as crRNA genes for sgRNA expression ...
-
bioRxiv - Cell Biology 2024Quote: alix and tsg101 were amplifed from cDNA using the Bio-Rad iScript kit and cloned into pJC53.2 (RRID:Addgene_26536) as previously described26 ...
-
bioRxiv - Plant Biology 2024Quote: ... The platinum TALEN ORFs designed to recognize the target sequences were assembled by platinum gate assembly kit (Addgene) (Sakuma et al. ...
-
bioRxiv - Cancer Biology 2023Quote: WNT3A and WNT4 were sub-cloned by Gateway recombination from the open-source Wnt library (Addgene Kit #1000000022) to the MAC-Tag-C vector (Addgene #108077 ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Biochemistry 2020Quote: ... TALENs were assembled using the Golden Gate TALEN and TAL Effector Kit 2.0 (57) and employing pC-GoldyTALEN as the final expression vector (#1000000024 and #38143 respectively; both from Addgene). Correct assembly of TALEN plasmid DNA was verified by restriction site analysis and sequencing and TALEN plasmids were transfected into wild type HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... was digested with NheI/KpnI and ligated with similarly digested pPD96.52 (Fire lab C. elegans Vector Kit 1999; 1608: L2534, Addgene) to generate pKMC166 (myo-3p::mCherry) ...
-
bioRxiv - Plant Biology 2022Quote: ... p35S:MPTMV-YFP + ERmCherry and p35S:MPToBRFV-YFP + ER-mCherry were assembled by Golden Gate cloning using the MoClo tool kit for plants (Addgene) (Weber et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... a region extending from the gene upstream of the transcription start site of a candidate gene plus the first exon and intron of that gene was fused to the sequence of GFP in plasmid pPD95.75 (Fire Vector kit, Addgene) which also contains the unc-54 3’UTR ...
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Cell Biology 2023Quote: ... Targeting sequence was cloned into pDD162 plasmid by using NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549) by using forward primer 5’-(CAAGCGAAAGAGTCGTCGAA)GTTTTAGAGCTAGAAATAGCAAGT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... TALENs were constructed according to the instruction provided by the TALE Toolbox kit from the Zhang laboratory (Sanjana et al., 2012) (Addgene, #1000000019). The target sequences for the left arm ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Genetics 2020Quote: ... The same kit was used to produce Cas9 D10A mRNA using as template the plasmid pCAG-T3-hCasD10A-pA (Addgene #51638). The 140bp ssDNA homology direct repair (HDR ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: GPCR coding sequences were provided by Bryan Roth (University of North Carolina, Chapel Hill, NC; PRESTO-Tango Kit—#1000000068, Addgene, Watertown), MA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: GPCR coding sequences were provided by Bryan Roth (University of North Carolina, Chapel Hill, NC; PRESTO-Tango Kit - #1000000068, Addgene, Watertown), MA ...
-
bioRxiv - Developmental Biology 2021Quote: Minos transposase mRNA was generated using the ThermoFisher mMESSAGE mMACHINE T7 or T7 ULTRA kit using NotI-digested pBlueSK-MimRNA (Addgene #102535). mRNA and concentrated DNA were mixed into a final concentration of 1 µg/µL in a solution of 0.1% phenol red in nuclease-free water ...
-
bioRxiv - Developmental Biology 2021Quote: ... were designed on ZiFiT (http://zifit.partners.org/ZiFiT/) and constructed using the Joung Lab REAL Assembly TALEN kit (a gift from Keith Joung; Addgene, Cambridge, MA, #1000000017), according to the provided protocol (Sander et al. ...
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Genomics 2020Quote: The CRISPR/Cas9 plasmid (CTCF-mouse-3sgRNA-CRISPRexp-AID) was assembled using the Multiplex CRISPR/Cas9 Assembly System kit57 (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized ...
-
bioRxiv - Genetics 2019Quote: ... Capped Cas9 mRNA was created by in vitro transcription using Thermo Fisher mMESSAGE mMACHINE™ SP6 Transcription Kit from pCS2-nls-zCas9-nls (Addgene#47929)
-
bioRxiv - Cancer Biology 2019Quote: ... and Gus (which is included in the BP reaction kit) were subcloned into the pLX301 vector (from David Root, Addgene plasmid #25895) using the Gateway LR Clonase II Enzyme mix from ThermoFisher (#11791020) ...
-
bioRxiv - Neuroscience 2020Quote: ... TAL effector modules were assembled and cloned into the array plasmids pFUS using the Golden Gate TALEN and TAL Effector kit (Addgene, Cambridge, USA) according to validated procedure (Cermak et al. ...