Labshake search
Citations for Addgene :
801 - 850 of 1801 citations for 6 tert Butyl 4 chlorothieno 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 HRE luciferase cells were generated by co-transfection of 3xHRE-luciferase construct (Addgene 26371) with a puromycin-resistant construct ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746; http://n2t.net/addgene:107746; RRID:Addgene 107746) [32] ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene, #78534). The puromycin resistance cassette in pLentiCRISPRv2 was replaced by a GFP gene using standard cloning techniques ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CamKII(1.3).eYFP.WPRE.hGH was a gift from Karl Deisseroth (Addgene plasmid# 105622; http://n2t.net/addgene:105622; RRID:Addgene_105622).
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077; http://n2t.net/addgene:27077;RRID:Addgene_27077) [pCXLE-hUL ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Cell Biology 2020Quote: HA-NFAT1(4-460)-GFP was a gift from Anjana Rao (Addgene plasmid # 11107). Patterned cells expressing NFAT-GFP was imaged using Zeiss LSM 880 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Cell Biology 2022Quote: ... was a gift from Sean Munro (MRC Laboratory of Molecular Biology). The CENPB-mCh plasmid (D. Liu et al., 2010) was generated by Michael Lampson and obtained from Addgene (#45219).
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Neuroscience 2024Quote: ... ±2.25, D/V: −3.10 (100 nl/injection, 25 nl/min infusion rate) and AAVrg-Ef1a-mCherry-IRES-Cre (Addgene, 55632-AAVrg) in the DLS at coordinates A/P ...
-
bioRxiv - Microbiology 2023Quote: ... The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The primer sequences used in amplifying human and mouse CUL1 and UBE2L3 coding sequences are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for glucose comprised residues 24–328 of the bacterial D-galactose-binding periplasmic protein (MglB) (Addgene plasmid #163115). Site saturation mutagenesis was carried out according to a previous protocol (Liu & Naismith ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids: 0.5×106 target cells were cultured in 6-well plates and transfected with pEGFP-SKL (Addgene#53450 from Jay Brenman Lab) plasmids using TurboFect Transfection Reagent (Thermo-Scientifics R0531 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were plated at 70-80% confluence in 6 well plates and transfected with 1μg of each plasmid containing 7a and 7b sgRNAs (Addgene #113620 and #113624) using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2019Quote: The B-cell acute lymphoblastic leukemia cell lines NALM-6 and REH were lentivirally transduced with plasmid expressing Cas9 nuclease (LentiCRISPR V2; Addgene Plasmid #52961) as described below at a MOI of 0.5 ...
-
bioRxiv - Neuroscience 2021Quote: Mice anaesthetized using isoflurane were bilaterally infused with pAAV2-hSyn-DIO-hM3D(Gq)- mCherry (≥ 6 × 1012 vg/mL; Addgene #44361, Lot v58216). After exposing the skull and creating small <2mm bilateral holes with a dental drill (Stoelting ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293T cells were plated at a density of 2.8×105 cells in 6-well plates and transfected with MSCV-flag-PRDM16 (Addgene, 15504; RRID:MSCV PRDM16) and/or pCDNA3-NKX2-174 using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Neuroscience 2023Quote: ... were designed to target CEP290 exon 6 and cloned into the pSpCas9(BB)-2A-GFP (PX458; gift from Feng Zhang; Addgene plasmid #48138). RPE1 cells were transfected with this plasmid by using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Immunology 2024Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ppyCAG_RNaseH1_WT employed for the transient overexpression of RNAseH1 in vitro on HEPA1-6 cells was a gift from Xiang-Dong Fu (Addgene plasmid #111906).
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Molecular Biology 2021Quote: ... (2) LwaCas13a coding sequence and Shine-Dalgarno sequence amplified from Addgene #91865 using primers oAM1496 and oAM1497 ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 2 μg of I-SceI expression plasmid pCBASceI (Addgene #26477) using lipofectamine® 3000 (#11668019 ...
-
bioRxiv - Biochemistry 2019Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Genomics 2019Quote: ... The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene. Exponentially growing 293T cells were split and seeded at 8 x 106 cells in 100 mm dishes in RPMI 1640 medium at 37C ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...