Labshake search
Citations for Addgene :
801 - 850 of 2137 citations for 6 METHYL 2H PYRIDO 1 2 A PYRIMIDIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Neuroscience 2024Quote: 120 000 iPS cells were plated on 12-well plates one day before the transduction by lentiviruses pLV_TRET_hNgn2_UBC_Puro (Addgene: 61474) and pLV_hEF1a-rtTA3 (Addgene:61472 ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319; http://n2t.net/addgene:54319; RRID: Addgene_54319) and mCherry-Paxillin-22 (Addgene plasmid # 55114 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-DIO-mCherry (control, titer 6 × 1012 cfu/ml, 250nl bilateral, #50459, Addgene), AAV5-hSyn-GFP-Cre (titer 3.5 × 1012 cfu/ml ...
-
bioRxiv - Immunology 2024Quote: ... grown in wells of 6-well plates with 1000 ng psPAX2 (Addgene plasmid #12260) packaging plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA targeting exon 6 of NFKB2 was cloned into lentiCRISPR v2 (Addgene plasmid # 52961), which is a constitutive CRISPR system ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... A cDNA for GFP-tagged mouse septin 6 was obtained from Addgene (plasmid #38296) and cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RD cells were transfected with the all-in-one Cas9/gRNA plasmid pSpCas9 BB-2A-GFP (PX458; Addgene; gRNA target sequence ...
-
bioRxiv - Cell Biology 2021Quote: The generation of stable knockout cell lines was achieved using the LentiCRISPRv2 system (one-vector system, Addgene #52961) or LentiGuide-Puro system (two-vector system ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Plant Biology 2023Quote: ... in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288; Addgene #50269), a C-terminal GR tag (pEPOZ0CM0137 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TC-71 were transduced with lentiviral Tet-pLKO- puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Cancer Biology 2023Quote: The one-step multiplex CRISPR-Cas9 assembly system kit was a gift from Takashi Yamamoto (Addgene Kit #1000000055) (2 ...
-
bioRxiv - Cell Biology 2021Quote: ... or into ‘All-in-one-GFP’ plasmid (AIO-GFP, gift from Steve Jackson (Addgene plasmid # 74119 http://n2t.net/addgene:74119; RRID: Addgene_74119))69 ...
-
bioRxiv - Cell Biology 2021Quote: ... Each guide RNA pair was cloned into either the ‘All-in-one-mCherry’ plasmid (AIO-mCherry, gift from Steve Jackson (Addgene plasmid # 74120; http://n2t.net/addgene:74120; RRID: Addgene_74120)) or into ‘All-in-one-GFP’ plasmid (AIO-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... anesthetized GAD1:Cre rats and wildtype littermates were injected with one of three AAV2 viral constructs obtained from Addgene: hSyn-DIO-hM4D(Gi)-mCherry ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Cancer Biology 2019Quote: ... RDES and TC-32 were transduced with lentiviral pLKO-TET-ON all-in-one vector system (Plasmid #21915, Addgene) containing a puromycin resistance cassette ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6 mice were injected with the AAV5-CAG-ChR2-mCherry adenovirus (200 nL, Addgene) in the PC ...
-
bioRxiv - Neuroscience 2021Quote: ... MEFs were then expanded to 6-well plates and transiently transfected with SV40T antigen (Addgene) and maintained until stably proliferative ...
-
bioRxiv - Neuroscience 2022Quote: [6] 15xQUAS from BAC-ECFP-15xQUAS_TATA-SV40 (a gift from Christopher Potter, Addgene ID #104875) (Riabinina et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... Each guide RNA pair was cloned into either the ‘All-in-one-mCherry’ plasmid (AIO-mCherry, gift from Steve Jackson (Addgene plasmid # 74120 ...
-
bioRxiv - Molecular Biology 2021Quote: ... gIL6 was cloned into the all-in-one plasmid hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-Puro-WPRE (Addgene #138147, ref18). DsRed plasmid was modified from pLenti-DsRed_IRES_EGFP (Addgene #92194 ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293FT cells were transfected with one of the three destination vectors plus a lentiviral packaging vector (psPAX2, Addgene plasmid #12260) and a VSV-G envelope expressing vector (pMD2.G ...
-
bioRxiv - Microbiology 2021Quote: The SpCas9 and guide RNA (gRNA) CRISPR components were both expressed from the one-vector lentiviral system “lentiCRISPR_v2” {25075903} (Addgene #52961). gRNA sequences for target genes were designed by submitting the sequence of an early exon (common to all isoforms ...
-
bioRxiv - Genomics 2021Quote: ... one set of cells received a lentivirus expressing the Cre recombinase under the control of the hSyn1 promoter (Addgene 86641). This induced expression of the dCas9p300 transgene in the neurons ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Bioengineering 2023Quote: ... Each well was transfected with 7.5 μg of one sgRNA plasmid of interest and 7.5 μg of a SpCas9 encoding plasmid (AddGene plasmid# 48137) through the calcium phosphate precipitation method as previously described (31) ...
-
bioRxiv - Genetics 2023Quote: ... in an all-in-one tetracycline- inducible expression cassette with AAVS1 homology arms (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343 ...
-
bioRxiv - Cancer Biology 2023Quote: ... which were designed by the Zhang lab to specifically target APOBEC3B53 were first subcloned into the all-in-one lentiCRISPR v2 plasmid (Addgene plasmid # 52961- a gift from Feng Zhang)53 ...
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Cell Biology 2022Quote: ... Tau fragments were subcloned into pcDNA3.1 by restriction digestion and further into pCW57.1- MAT2A all-in-one tet-off lentiviral backbone (a gift from David Sabatini (Addgene plasmid # 100521))71 by Gibson assembly ...
-
bioRxiv - Molecular Biology 2022Quote: U-2 OS CRISPR knockout lines were generated using the All-in-One plasmid encoding dual sgRNAs and fluorescent protein-coupled Cas9D10A nickase (AIO-GFP; Addgene #74119) (Chiang et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were synthesized and subcloned into the BsmBI site of the all-in-one (dox-inducible Cas9-2A-eGFP and constitutive U6 promoter) TLCV2 vector (Addgene #87360). sAC-targeted sgRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Physiology 2020Quote: ... Mice were injected in each side or one side of the DMH with ∼0.5 µL AAV2-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, USA), AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene) ...
-
bioRxiv - Genetics 2020Quote: ... All-in-one-plasmids encoding both Cas9 and the desired sgRNA were created by site-directed mutagenesis of pDD162 (Addgene #47549) (Dickinson et al ...
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...