Labshake search
Citations for Addgene :
801 - 850 of 2747 citations for 6 Isoquinolinol 1 2 3 4 tetrahydro 1 4 methylphenyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2VP16 was generated by fusing the open reading frame for the herpes simplex virus-1 (HSV-1) VP16 (amplified from pActPL-VP16AD plasmid, Addgene plasmid #15305, Watertown, USA) activation domain to Err2 ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Puro DEST (w118-1) and pLenti CMV Blast DEST (706-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17398, #17452, #17451). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene plasmids #12259 ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Synthetic Biology 2019Quote: Were-1 DNA was cloned into the pBV-Luc (Addgene) vector in order to obtain a fused riboswitch-firefly luciferase (Fluc ...
-
bioRxiv - Cancer Biology 2019Quote: ... a lentiviral vector pLKO.1 (Addgene, 8453, Cambridge, MA, USA) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-DIO-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pLKO.1-Tet-Neo obtained from Addgene. For inducible shRNA constructs ...
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-puro (Addgene #52628, a gift from Scot Wolfe) and the modified pLKO.1-puro/GFP vector system described in (Phelan et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47802 (Addgene, catalog number: 48007). Level 1 pICH47811-pTCSn::nls:tGFP::tATPase (position 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47811 (Addgene, catalog number: 48008). To amplify IPT3 promoter (gene ID v4 ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1-puro-shNT (gift from Jacob Corn, Addgene #109012) was used as a scrambled shRNA control ...
-
bioRxiv - Cell Biology 2021Quote: ... and AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399)
-
bioRxiv - Neuroscience 2021Quote: ... Animals were injected with saline-diluted AAV2/1.hSyn.GCaMP6f.WPRE.SV40 (Addgene) at a depth of 250 and 550 µm (final concentration ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by pLenti-CMV-Puro DEST vector (Addgene, w118-1). The plasmids were propagated in DH5α bacterial cells (Life Technologies) ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2019Quote: ... and β-arrestin 1-FLAG (#14687) were obtained from Addgene.
-
bioRxiv - Cancer Biology 2019Quote: ... expressed from a pLKO.1-hygro plasmid backbone (Addgene #24150). Three days after lentiviral transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 constructs were co-transfected with psPAX2 (Addgene 12260) and VsvG (Addgene 8454 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb_EfrCD#1 was cloned into expression plasmid pBXNPHM3 (Addgene #110099) using FX cloning and expressed as described previously [42] ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.1.hSyn.dio.EGFP (anterograde labelling, 140 nl, Addgene, no. 50457); retrograde.AAV.hSyn1.chI.mCherry.2A.iCre.WPRE.SV40p (retrograde labelling of LHb inputs and whole-brain clearing ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Cat # AV-1-ALL854, RRID:Addgene_51502 ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-DIO-stGtACR2-FusionRed (Addgene, 4.2E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... to inject 1 μl pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene, catalog # 105551-AAV9) or 1 μl pENN.AAV.CamKII0.4.eGFP.WPRE.rBG (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... The following AAVs were injected: 1) AAV1.hSyn.cre.WPRE.hGh (Addgene #105553) at one of three doses (1.73×1012 ...
-
bioRxiv - Immunology 2022Quote: ... et al 16 were purchased from Addgene (Supplemental Table 1), and used to make stable expression cell lines in HEK293 cells by lentiviral transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral injections of 1 μl hSyn.iGluSnFr.WPRE.SV40 (Addgene, plasmid #98929-AAV1) for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IMS using SMAC (residues 1-59, from Addgene 136469), the IBM using IMMT (residues 1-18734) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the Level 1 acceptor plasmids pL1P3-TaU6 (Addgene #165599) and pL1P4-TaU6 (Addgene #165600) ...