Labshake search
Citations for Addgene :
801 - 850 of 2154 citations for 1 Bromo 3 difluoromethoxy benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... h-lin-28 and EBNA-1 (Addgene plasmids #27077 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 μg of psPAX2 (Addgene #12260), and with 21 μL of TransIT-Lenti (Mirus #6603) ...
-
bioRxiv - Genomics 2020Quote: ... and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/1.hSyn.ChR2(H134R)-eYFP.WPRE.hGH (Addgene 26973P) was injected in the pulvinar in the left hemisphere ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg pMD2.G (envelope plasmid; Addgene), and 3 μg psPAX2 (packaging plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLKO.1 puro GFP siRNA (Addgene, # 12273)43 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg gag/pol (psPAX2, Addgene, 12260), and 0.25 μg VSV-G (pMD2.G ...
-
bioRxiv - Biochemistry 2021Quote: ... pCMV6-XL4 ASXL1 (1-1304) (Addgene # 74244); pCMV6-XL4 ASXL1 (p.Y591X ...
-
bioRxiv - Microbiology 2021Quote: ... pet41s GST ATF6αTAD (aa 1-150) (Addgene) contained the TAD domain.
-
bioRxiv - Cell Biology 2023Quote: ... and KIF5C(1-560)-mCit (Addgene #61676) were a gift from Kristen Verhey92 ...
-
bioRxiv - Cancer Biology 2023Quote: ... LV-Cre pLKO.1 (Addgene plasmid 25997), which encodes Cre-recombinase in the backbone of the pLKO.1 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... 1/10th mass BirA (Addgene plasmid 20857), and 50 µM D-biotin at 30 °C for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg psPAX2 (Addgene plasmid #12260) in 50 μL Opt-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into pLKO.1 (Addgene #10878). The VSV-G envelope expressing plasmid pMD2.G ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μg packaging plasmid (Addgene #12260). 24 hours post transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... and inserted into pLKO.1 Vector (Addgene). To package the third generation lentiviral vectors ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD2.G (1 µg, Addgene, 12259), plus the pscALPS-hACE2 or -cACE2 (1 µg ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1 × 1013 copies/mL) (Addgene, Watertown, MA) were injected into the PeF (250 nL/side ...
-
bioRxiv - Cell Biology 2022Quote: ... kif5b(1-560)-EGFP-6His (AddGene #15219), and Sfp-6His (AddGene #75015 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty pKLO.1-hygro (Addgene, 24150) were used as negative controls.
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G (1 µg; Addgene, Cat# 12259) and psPAX2 (2 µg ...
-
bioRxiv - Developmental Biology 2024Quote: ... and peroximal targeting signal 1 (Addgene, 54520) were cloned into mCherry-bearing pcDNA6 (Golgi-mCherry and PEX-mCherry) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pLKO.1-TRC-control (Addgene_#10879) (Moffat et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.hSyn.GRAB_DA2h (1 x 1013GC/mL, Addgene) was used to detect dopamine (Sun et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-2/1/CAG-Flex-EGFP (Addgene), pENN.AAV.hsyn.Cre.WPRE.hGH (AAV1 ...
-
bioRxiv - Immunology 2024Quote: ... 1 μg of pMDLg/pRRE (Addgene #12251), and 1 μg of pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Molecular Biology 2024Quote: ... vector backbone carrying spCas9 cDNA from Addgene #48138 and mCat-1 cDNA from Addgene #17224 (see Note 1).
-
bioRxiv - Genetics 2024Quote: ... and 1 µg of Flippase (Addgene 1379382) recombinases were transfected ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We used plasmid 1 (Addgene #176640 (21)) as the base plasmid for Library 1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Vector PLKO.1 Neo (shCtrl; Addgene, 13425) and Egfp open reading frame (Egfp OE ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1-TRC cloning vector (Addgene), psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and pLKO.1-shDrp1-GFP (RRID: Addgene_228737).
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).