Labshake search
Citations for Addgene :
751 - 800 of 1120 citations for Recombinant Human ABHD15 His tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... cDNA for human β1-integrin was obtained by PCR using a template plasmid from Addgene (#69804), the sequence was modified to introduce BamHI and NotI restriction sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA sequences were adapted from the human CRISPR metabolic gene knockout library (Addgene pooled library #110066)5 and included genes from the Metabolic Atlas (Human-GEM v1.3.0) ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which included ∼19,000 genes with 4 sgRNAs per gene and 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 C-terminal half (GST-LIC 389-523) was a gift from Ron Vale (Addgene plasmid #74599 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9D10A nickase (hSpCas9D10A; a gift from Peter Duchek) (Addgene plasmid ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cambridge, MA). Chimeric guide RNA expression cassettes with different sgRNAs (sgRNA1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The sgRNA against human TSC2 gene 60 was subcloned into the lentiCRISPR v2 lentiviral vector (Addgene #52961). For lentiviral transduction ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Neuroscience 2021Quote: The immortalized human Schwann iHSC-1λ were infected with lentivirus derived from pLentiCRISPRv2 puro (Addgene, Cat#78852) expressing Cas9 and either a scrambled gRNA or one directed against the human NF1 gene designed to cleave between amino acids 157 and 158 in Exon 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mammalian cells were transfected with either the empty vector (pAAV) or human WT aSyn pAAV vector (Addgene plasmid # 36055 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178). The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding a mCherry-labeled dominant negative mutant version of human Rab5A was from Addgene (Cat# 35139). GFP-hRab5B.dn3 (#1008 ...
-
bioRxiv - Bioengineering 2020Quote: ... we used the human codon optimized Cas9 from lentiCRISPR v2 plasmid (Addgene 52961, Sanjana et al., 2014) as background for xCas9 and Cas9-NG mutations ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E. Perez-Reyes, Addgene #45810 (Gomora et al. 2002) in combination with green fluorescent protein.
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Cell Biology 2020Quote: Human Rab21 (aa 16-225) constructs were cloned into a Gateway destination vector pgLAP1 (Addgene plasmid #19702) to express Rab21 with an N-terminal GFP followed by a TEV cleavage site and an S-Tag in mammalian cells ...
-
bioRxiv - Biochemistry 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048),pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230), and lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-cas9-based guide RNA (gRNA) targeting human EED (GATCATAACCAACCATTGTT) was cloned in LentiCRISPR v2 (Addgene 52961), which was mixed with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which covered ~19,000 genes with 4 sgRNAs per gene along with 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Microbiology 2020Quote: Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat and obtained from Addgene (#90294). It is a one-component library with guide-RNAs inserted in lentiCRISPRv2 backbone as well as the cas9 gene ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Immunology 2022Quote: ... pEGFP-LC3 (human) was a kind gift from Toren Finkel (Lee et al., 2008) (Addgene plasmid # 24920).
-
bioRxiv - Cancer Biology 2023Quote: ... Human melanoma cell lines with fluorescent BRN2 reporter were further transduced with pHIV-Luc-ZsGreen (Addgene 39196) and selected with neomycin (800 μg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR–Cas9 screen was performed using the whole genome human Brunello CRISPR knockout pooled library (Addgene #73178) (PMID ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Biochemistry 2023Quote: Human OGG1 WT or OGG1 K249Q in a pET-His6-GFP-TEV bacterial expression vector (Addgene #29663) were obtained from GenScript ...
-
bioRxiv - Cell Biology 2023Quote: ... a human colon line (HUB-02-A2-040) was lentivirally transduced with pGK Dest H2B-miRFP670 (Addgene). Lentiviral transduction was performed on single cells after 0.05% Trypsin EDTA (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... Reads were then mapped to a FASTA file generated from the Bassik Human CRISPR Knockout Library (Addgene), clipped to remove one nucleotide at the 5’ end of each read (due to an excess of mismatches at this position) ...
-
bioRxiv - Microbiology 2022Quote: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) and amplified according to instructions ...
-
bioRxiv - Biochemistry 2023Quote: A pProEx-IDE-wt (#99014) plasmid containing cloned human IDE (Met42–Leu1019) was purchased from Addgene (UK). The plasmid encoded a 6-histidine tag at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2023Quote: ... human RXRa cDNA was PCR-amplified from pSV-Sport-RXRα (a gift from Bruce Spiegelman; Addgene #8882)68 ...
-
bioRxiv - Neuroscience 2024Quote: The following constructs were used: human CACNA1B (hα1B; variant +e10a, +18a, Δ19a, +e31a, +e37b and +e46; Addgene #62574 ...
-
bioRxiv - Neuroscience 2024Quote: Plasmid containing iGluSnFR(A184S) under the control of the human synapsin promoter was purchased from Addgene (#106174) and packaged in the AAV8-Y733F serotype (Dalkara et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... LUC7L2 and LUC7L3 ORFs were amplified from human cDNA and cloned into pcDNA3.1(+)IRES GFP (Addgene #: 51406). Domain swap constructs were synthesized as gblocks from IDT and cloned into pcDNA3.1(+)IRES GFP ...
-
bioRxiv - Biochemistry 2024Quote: Human interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) gene (Gene ID: 3434) was obtained from Addgene in the plasmid vector pET28a_IFIT1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human TP53 (tumor protein 53, p53) was amplified from plasmid pLenti6 / V5-p53_wt p53 [bought from Addgene, catalog number #22945] ...
-
bioRxiv - Developmental Biology 2024Quote: ... HA- human HA-Ubiquitin was a gift from Edward Yeh (Addgene plasmid # 18712; Kamitani et al., 1997)
-
bioRxiv - Cancer Biology 2024Quote: The Human Brunello CRISPR KO library was a gift from David Root and John Doench (Addgene #73179) (Doench ...
-
bioRxiv - Cell Biology 2024Quote: ... Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene # 73178) (33) ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid expressing the human ACE2 protein with a C-terminal C9 tag was obtained from Addgene (Plasmid 1786). 293T cells were transduced with retroviral particles carrying a pQCXIP vector encoding the gene for the human ACE2 protein ...
-
bioRxiv - Genetics 2021Quote: ... and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498)) or the catalytic domain (CD ...
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral particles were produced in the Human Embryonic Kidney 293T (HEK293T) cell line with the psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...