Labshake search
Citations for Addgene :
751 - 800 of 1581 citations for Rat Insulin Like Growth Factor 1 Receptor IGF1R ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Targeting sequence was cloned into pDD162 plasmid by using NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549) by using forward primer 5’-(CAAGCGAAAGAGTCGTCGAA)GTTTTAGAGCTAGAAATAGCAAGT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and then recombined into the destination vector pLenti CMV Blast DEST (706-1, Addgene) plasmid ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected using 0.25µg pCMVHA E2F1 (24225 from Addgene, RRID: Addgene_24225) with a JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected using 0.25µg pCMVHA E2F1 (24225 from Addgene, RRID: Addgene_24225) with a JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Genomics 2020Quote: ... and pMA122 - peel-1 negative selection (Addgene plasmid # 34873; http://n2t.net/addgene:34873; RRID:Addgene_34873) were gifts from Dr ...
-
bioRxiv - Genetics 2020Quote: ... the NLS:LEXA (1-214aa) fragment from the pBPnlsLexA::GADflUw plasmid [35] (Addgene plasmid #26232) was cloned in frame in a myc-BAP170 (2-1688 aa ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG was cloned into pLenti CMV Puro DEST (w118-1) (Addgene plasmid #17452) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... pcDNA4 myc PGC-1 alpha was a gift from Toren Finkel (Addgene plasmid # 10974). pSG5 PPAR alpha was a gift from Bruce Spiegelman (Addgene plasmid # 22751) ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Neuroscience 2019Quote: The plasmids used for transfection were listed (1) cis plasmid pAAV.hSyn.eGFP.WPRE.bGH (Addgene Cat# 105539) and pAAV-hSyn-eGFP (Addgene Cat# 50465) ...
-
bioRxiv - Immunology 2019Quote: ... AAV carrying Cre-dependent tdTomato cassette (AAV2/1.CAG.Flex.tdTomato.WPRE.bGH, titer ≥1013 vg/mL, Addgene) was injected into the iLN Nav1.8Cre/+ animals as described above ...
-
bioRxiv - Genetics 2020Quote: ... The selected sgRNAs (Table 1) were cloned into plasmid pSpCas9(BB)-PX330 (Addgene #42230), using the BbsI site ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid pcDNA3.1-GFP(1-10) was a gift from Bo Huang5 (Addgene plasmid 70219). The fragment encoding for GFP1-10 was isolated via PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid pEGFP-N1 with a CMV promoter was also used (Addgene #6085-1). All constructs were verified by sequencing (Eurofins and Genewiz) ...
-
bioRxiv - Cancer Biology 2020Quote: ... which will be available through Addgene: (1) SpCas9 sgRNAs expressed using LRG2.1 (Addgene, 108098), (2 ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1 - TRC cloning vector was a gift from David Root (Addgene plasmid # 10878)(89) ...
-
bioRxiv - Neuroscience 2020Quote: ... oChIEF was manufactured by Virovek (AAV2/1.CAG.flex.oChIEF.tdTomato, Addgene 30541, 2.2×1013 GC/ml). For anatomical experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-EF1a-DIO-hChR2-eYFP (UPenn Vector Core AV-1-20298P / Addgene 20298-AAV1) or AAV9-CAG-DIO-ChroME-ST-p2A-H2B-mRuby (generously provided by Hillel Adesnik) ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV1-CamKIIa-hChR2-mCherry (UPenn Vector Core AV-1-26975 / Addgene 26975-AAV1) were used for non-conditional axon labeling ...
-
bioRxiv - Cell Biology 2021Quote: To determine the cytosolic volume of all cell lines pEGFP-N1 (Addgene# 6085-1) was transiently overexpressed ...
-
bioRxiv - Cell Biology 2020Quote: ... according to manufacturer’s instructions with pLenti CMV/TO Puro DEST (670-1) (Addgene 1729).
-
bioRxiv - Cancer Biology 2022Quote: ... or control vectors pGIPZ (Dharmacon) or pLKO.1 (a gift from David Sabatini, Addgene plasmid #1864 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/1-Ef1a-fDIO-hChr2-eYFP was a gift from Karl Deisseroth (Addgene 55639); pAAV2/1-EF1a-DIO-hChR2-eYFP was a gift from Karl Deisseroth (Addgene #20298) ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV2/1-EF1a-DIO-hChR2-eYFP was a gift from Karl Deisseroth (Addgene #20298); AAV2/1-hSyn-fDIO-DTA (NYUAD) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474); AAV(PHP-eb)-hSyn-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #44361) ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1 - TRC cloning vector was a gift from David Root (Addgene plasmid # 10878) (94) ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878)(94) ...
-
bioRxiv - Cancer Biology 2020Quote: ... or pLKO.1-shSIN3A lentiviruses was conducted according to a protocol described by Addgene. Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... HA-SUMO-1 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48966). HA-SUMO-2 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48967) ...
-
bioRxiv - Biophysics 2021Quote: ... with 1 μg of DNA plasmid vector Cry2Olig-mCherry (purchased from Addgene, number 60032), and then platted on fluorodishes ...
-
bioRxiv - Molecular Biology 2021Quote: ... lentiviruses were produced in HEK293T cells in a pLKO.1-puro (Addgene, plasmid 8453) backbone ...
-
bioRxiv - Genomics 2021Quote: ... IMR90 cells were transfected with 1 µg of pEGFP-Δ50 LMNA (Addgene Plasmid #17653). After expression of the GFP was observed (∼2 days) ...
-
bioRxiv - Plant Biology 2021Quote: ... pENTR4-GFP-C3 (w393-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17397 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and corresponding 1-kbp homology arms were cloned into pHD vector (pHD-DsRed, Addgene plasmid #51434 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 million cells were nucleofected with iμg pAAV-CAG-GFP plasmid DNA (Addgene 37825) in Ingenio electroporation buffer (Mirus MIR50111 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µg of the resulting plasmid and 0.5 µg of plasmid hCas9 (Addgene 41815) were co-transfected using 3 µl of Turbofect transfection reagent (Thermo Fisher) ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... The oligonucleotides for shRNA were cloned into the pLKO.1-TRC vector (Addgene #10878) using AgeI/EcoRI ...
-
Evolutionary plasticity of SH3 domain binding by Nef proteins of the HIV-1/SIVcpz lentiviral lineagebioRxiv - Microbiology 2021Quote: ... and HIV-1 P RBF168) were cloned into the pWPI-GFP vector (Addgene # 12254) to transduce Jurkat cells stably expressing CD4.
-
bioRxiv - Cancer Biology 2020Quote: ... The shRNA sequences were assembled into a pLKO.1 lentiviral backbone (Addgene plasmid #10878), containing a puromycin resistance marker to allow for the antibiotic selection of transduced cells ...
-
bioRxiv - Neuroscience 2021Quote: ... The pLKO.1 TRC cloning vector was a gift from David Root (RRID: Addgene_10878) (Moffat et al. ...
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Cancer Biology 2022Quote: ... oligonucleotides of the same sequence (TRCN0000111876) were cloned into pLKO.1-blast (Addgene #26655). Cells transduced were selected in culture containing puromycin (InvivoGen ...
-
bioRxiv - Cancer Biology 2022Quote: ... β-catenin shRNA was purchased from Addgene (pLKO.1 puro shRNA β-catenin #18803). Scramble siRNA and p68 siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Neuroscience 2022Quote: ... a volume of 1-1.2 μl of the viral plasmid pAAV.hSyn.Flex.iGluSnFR.WPRE.SV40 (gift from Dr. Loren Looger; Addgene plasmid # 98931 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 4.5 × 1013 GC/ml (Cat # AV-1-ALL864, RRID:Addgene_51503; U Penn Vector Core).
-
bioRxiv - Neuroscience 2022Quote: ... 10 μL of AAV-PHPeB-hsyn-cre-eGFP (Addgene#105540, titer ∼1×10^13) or AAV-PHPeB-CAG-GFP (Addgene#37825 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have combined them all in a pX330A-dCas9 1×6 (Plasmid #63600, Addgene). Cloning of oligonucleotides was confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... we cloned the shRNA targeting TET2 into the pLKO.1-blast vector (Addgene #26655). Plasmids were generated using PCR ...