Labshake search
Citations for Addgene :
751 - 800 of 2056 citations for RGPD1 2 3 4 5 8 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 5×NF-κB_RE::RedF (#124530; Addgene, Watertown, MA, USA) is the reporter plasmid consisting of a red firefly luciferase driven by a minimal promoter containing five NF-κB-binding sites (NF-κB-Luc ...
-
bioRxiv - Immunology 2022Quote: ... The Vκ1-33/CBE replacement of Vκ3-2 was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and two guide RNAs that target the mouse Vκ3-2 segment ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Genomics 2019Quote: The plasmid pCMV-myc-Atg7(2) expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1 ...
-
bioRxiv - Microbiology 2022Quote: ... pLenti-X2-Zeo-DEST (749-3) [a gift from Eric Campeau (Addgene, 21562)] and the donor vector ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264 ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA 3-CDK9 HA plasmid was purchased from Addgene (ID 14640, RRID:Addgene_14640), which was originally established by Dr Matija Peterlin (43) ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected with RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Neuroscience 2024Quote: ... 750 nl of the retroAAV-hsyn-Cre (500nL, Addgene Lot v70508, 3*1013) was injected in the VTA of male and female C57/BL6 mice ...
-
bioRxiv - Genetics 2023Quote: ... and a poly-A p-3’entry clone (Addgene, Kristen Kwan, Chien lab) were used.
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... and the p10-3’UTR PCR amplified from the plasmid pJFRC81 (Addgene #36432). These were then cloned by Gibson assembly (NEB ...
-
bioRxiv - Genetics 2024Quote: ... and 3’ UTR was PCR-amplified and cloned into the pGRB2.0 plasmid (Addgene) (73 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-hM4Di-mCherry (1μL per site, titer ≥ 3 ×1012 vg/mL, Addgene) was stereotactically injected into the dHP (coordinates ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The ho1-pcy gene was derived from the pNO286-3 plasmid (Addgene #107746) that was deposited by Ong et al.59 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The TdT gene was cloned into a pET28a expression vector (Addgene #69864-3) with an N-terminal 10xHis tag ...
-
bioRxiv - Neuroscience 2024Quote: ... was co-injected at a 3:1 ratio with AAV5-gfaABC1D::mCherry (Addgene #58909-AAV5 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: MEFs were transfected with 4 μg of 8xGTIIC-luciferase (Addgene, #34615), SBE2-luciferase (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV2.CAG.tdTomato (Addgene, #59462-AAV2, titer: 4×10¹² vg/mL) were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-12 weeks old Ucn3::Cre male mice were stereotaxically injected with pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...