Labshake search
Citations for Addgene :
751 - 800 of 1458 citations for Mouse Anti Human Papilloma virus type 18 718 238 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cell Biology 2019Quote: ... The H2B-mRFP expression construct for human cells was obtained from Addgene (#26001), transfected to 293T cells to produce viruses and infect HeLa Cyclin B1-Venus expressing cells to generate a stable cell line ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human CTNNB1 expression plasmid deposited by Eric Fearon was purchased from Addgene (#16828). CD24 cDNA cloned into the pCDNA3.1 vector and the full-length 3′-UTR of CD24 cloned into pMIR (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human MRTFA was amplified out of the p3xFLAG-MRTFA vector (Addgene plasmid#11978) and tagged with gateway adapters which preserve the N-terminal 3x FLAG tag from the vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...
-
bioRxiv - Neuroscience 2022Quote: ... The V5-tagged human GLUT1 construct was a gift from Wolf Frommer (Addgene) 89 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The designed sgRNAs were cloned into human lentiCRISPR v2 vector (Addgene, MA, USA). For lentiviral packaging ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T target cells transfected with 500ng of a human ACE2 expression plasmid (Addgene) were seeded at 2×104 in 100μL DMEM-10% in a white-bottomed 96-well plate (Corning ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Bioengineering 2022Quote: ... we utilized the Human Genome-wide CRISPRa-v2 Library (Addgene Pooled Libraries #83978) consisting of 104,540 sgRNAs targeting 18,915 genes (top 5 sgRNAs per gene) ...
-
bioRxiv - Cell Biology 2022Quote: Point mutations were generated on a human fibronectin pMAX vector plasmid (Addgene, #120402) using the Q5 site-directed mutagenesis kit (BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: Human ATG9A was amplified from pMXs-puro-RFP-ATG9A from Addgene (plasmid #60609) and subcloned into the EGFP-N1 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... Brunello library targeting all human protein-coding genes28 was purchased from Addgene (#73179). Quality of the MYC-CRISPR and Brunello libraries was verified by next-generation sequencing on Illumina platform (BGI ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MCU-GFP plasmid was a gift from Vamsi Mootha (Addgene plasmid # 31732).
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Cell Biology 2023Quote: A vector expressing HA-tagged human E6AP was obtained from Addgene (Plasmid #8658), E6AP mutants were generated using site-directed mutagenesis (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CRISPR Knockout library was a gift from Michael Bassik (Addgene #101927). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... All the sgRNAs targeting human genes were cloned into lentiCRISPR v2 (Addgene, #52961), lentiCas9-Blast (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: The gRNA library targeting >1500 human miRNA loci was obtained from Addgene (32). MutuI cells were transduced with lentiparticles derived from the doxycycline inducible Cas9 vector pCW-Cas9 (Addgene Plasmid #50661 ...
-
bioRxiv - Biochemistry 2024Quote: An expression plasmid of human GST-Cdk2 was purchased from AddGene (plasmid #61845) and used without further subcloning ...
-
bioRxiv - Biophysics 2024Quote: The coding sequence of human fascin1 (GeneBank, NM_003088.4) was obtained from Addgene (#31207) and subsequently inserted into a pGEX-6p-1 vector (Cytiva ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Cell Biology 2020Quote: For the generation of stable A549 cell lines expressing various PKCs and mutants we used following plasmids: pcDNA3-PKCε-Flag (wild-type, Addgene, Cambridge, MA), pcDNA3-Flag-K312PKCε ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: The Tau/pET29b plasmid used for wild type FLTau (2N4R) expression and purification was a gift from Peter Klein (Addgene plasmid #1631683).
-
bioRxiv - Cell Biology 2019Quote: ... Lztfl1-/- cells (Figure S2) were obtained by genome editing of immortalized wild type MEFs using guide (gMS04: GCTCGATCAAGAAAACCAAC) cloned into pLentiCrisprV2 (Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2019Quote: The human kinome ORF library in pDONOR223 was obtained from Addgene (Cambridge, MA, 1000000014) and cloned into a custom pHAGE-CMV-FLAG destination vector using Gateway cloning technology ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Genomics 2020Quote: Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene #1000000048) (16) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207 ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX6P1-human full-length LIC1 plasmid was a gift from Ron Vale (Addgene plasmid # 74597 ...
-
bioRxiv - Biophysics 2022Quote: The gene with codon-optimized human dysferlin cDNA was obtained from Addgene (Plasmid 67878) [47] ...