Labshake search
Citations for Addgene :
751 - 800 of 1273 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injection mixes were prepared in MilliQ H2O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a 3’ untranslated region and terminator sequence (3UTR) from Agrobacterium tumefaciens octopine synthase (AtuOCS) (pICH41432, Addgene #50343). A calibrator construct (pEPYC1CB0197 ...
-
bioRxiv - Immunology 2021Quote: ... an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24 ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al. ...
-
bioRxiv - Cell Biology 2021Quote: tdTomato-ER-3 and LAMP1-Clover (Clover-Lysosomes-20) were gifts from Michael Davidson (Addgene #58097 and #56528). Mito-PhiYFP (pPhi-Yellow-mito ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898; http://n2t.net/addgene:83898; RRID:Addgene_83898) 51 to express ArchT 67 fused to TS-EYFP-ER sequence that was cloned from a pcDNA3.1 CMV-ChRmine-TS-EYFP-ER plasmid gift of the Hegemann laboratory at the Humboldt Universität ...
-
bioRxiv - Genetics 2024Quote: ... using 3 µg of pCAG-NLS-HA-Bxb1 plasmid (a kind gift from Pawel Pelczar (Addgene plasmid #51271) (Hermann et al ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmid encoding the sequence of the cleavage site for Caspase 3 (DEVD) and FLIP-GFP reporter (Addgene# 124428) was digested using the NheI_HF and XmaI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The standard transfection mixture included 3 μg of total DNA [1.5 µg lentiviral plasmid + 1.5 µg helper plasmids - psPAX2 (RRID: Addgene_12260) and pMD2.G (RRID ...
-
bioRxiv - Biochemistry 2023Quote: The construct for E.coli expression of WT caspase-3 (pET23b-Casp3-His) was obtained from Addgene (plasmid 11821). The construct for mammalian expression of caspase-3/GFP was a gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... The lin-3 guide sequence was inserted into pDD162 (eef-1A.1p::Cas9 + empty sgRNA, Addgene plasmid #47549) using Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276; http://n2t.net/addgene:73276 ; RRID:Addgene_73276) General yeast manipulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Neuroscience 2024Quote: ... an oligonucleotide pair (Supplemental Table 3) was annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410) as described (Port et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Molecular Biology 2020Quote: The hCRIPSRi-v2 library top 5 sgRNAs/ gene (Horlbeck et al. 2016)(Addgene # 83969), was a gift from the Jonathan Weissman lab at UCSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (gifted from Melina Fan [Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964]), pAAV2/7 (gifted from James M ...
-
bioRxiv - Immunology 2024Quote: ... Two BA.5 NTD DMS libraries were further assembled into pETcon 2649 vector (Addgene) and electroporated into electrocompetent DH10B cells for plasmid amplification ...
-
bioRxiv - Neuroscience 2024Quote: ... a backbone plasmid of pLV.PARP1#5 (a gift from Didier Trono - Addgene plasmid # 14548), to produce pLV.Usp14shRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μg of pMD2.G envelope plasmid (Addgene #12259, generated in Dr Trono’s lab) and 2.5 μg of pRSV-Rev plasmid (Addgene #12253 ...
-
bioRxiv - Cancer Biology 2024Quote: 10 µg of the expression plasmid and 5 µg pCL-Eco (Addgene plasmid #12371) were co- transfected into Pheonix-Eco cells in the culture medium without antibiotics ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fibroblasts were reprogrammed by electroporation delivery of episomal vectors pCXLE-hOCT3/4-shp53-F (Addgene, 27077), pCXLE-hSK (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected 4 DIV neurons with adeno-associated virus (AAV) expressing CamK2a-Cre (Addgene# 105558-AAV1) - pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen-inducible Rosa26::CreERT2 embryo and immortalized by transduction of pMXs-hc-MYC (Addgene 17220) followed by limiting dilution and clone derivation (see “iMEF B” in ref ...
-
bioRxiv - Cancer Biology 2023Quote: ... the following lentiviral vectors were used at an MOI of 4 (96h): pWPXL-SOX4 (Addgene 36984), HA-tagged SOX4 [43] or empty vector control (Addgene 12257) ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446 ...