Labshake search
Citations for Addgene :
751 - 800 of 1706 citations for 2 4 6 Trichlorophenol 13C6 99% 100 Ug Ml In Isooctane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 gRNA plasmids were generated per construct and were integrated into pX330 (Addgene# 42230) using BbsI site as previously described 16 ...
-
bioRxiv - Molecular Biology 2019Quote: ... HA-SUMO-2 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48967). Flag-PIAS4 WT plasmid was a gift from Ke Shuai (Addgene plasmid # 15208) ...
-
bioRxiv - Neuroscience 2019Quote: ... astrocytes were transfected with 2 μg of pLYS1-FLAG-MitoGFP-HA (Addgene plasmid # 50057) which contains the pore-forming subunit of the mitochondrial calcium uniporter coupled to GFP or a mito-mCherry construct generated by subcloning the targeting sequence of the pLYS1-FLAG-MitoGFP-HA plasmid into the mcherry2-N1 vector (Addgene plasmid # 54517) ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Neuroscience 2022Quote: ... or ssAAV-9/2-hEF1a-dlox-eNpHR3.0_iRFP(rev)-dlox-WPRE-hGHp(A) (ETHZ/UZH Viral Vector Facility, titre: 7.2 × 1012 vg/mL) or pAAV-flex-GFP (Addgene, titer: 2.5 ×1013 vg/mL) for activation ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV-pkg-Cre (Addgene 24593-AAVrg; 1.7×1013 GC/ml) was injected into either the ipsilateral (right ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-CaMKII-eYFP (titer 1.9 × 1013 vg/ml, Addgene, #105622) was used.
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml, Addgene) viruses were injected with a 10μl Neuros syringe (Hamilton ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL of rAAV2-retro jGCaMP7s (~1e13 gc/mL, Addgene) was injected at a rate of 70 nL·min-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-EF1a-DIO-eYFP (1.3×1013 GC/ml, Addgene) were using a Nanoject III instrument (Drummond ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5-EF1a-DIO-eYFP (1.0 × 10e13 GC/ml, Addgene) were injected into POm and S1 of Rbp4-cre mice ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV5-hSyn-eNpHR3.0-eYFP (2.3 × 10e12 GC/ml, Addgene) into the SP5i (AP -6.6 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1α-DIO-hM3Dq-mCherry (2.4×1012 vg/ml, Addgene plasmid #50460-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Cat # AV-1-ALL854, RRID:Addgene_51502 ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-DIO-stGtACR2-FusionRed (Addgene, 4.2E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV1-CAG.FLEX.GFPsm_myc.WPRE.SV40 (1.12E+13 GC/ml) was purchased from Addgene. EnvA+ RVdG-5PSD95eGFP-SynPhRFP (1.55E+08 IU/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Ef1a-DIO EYFP (∼1x1013 GC/ml, 300 nl, Addgene) was bilaterally injected into VTA and SN of 10 wk old mice ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV9.CAG.Flex.GCaMP6s.WPRE.SV40 (1.9 x 1013 vg/ml, Addgene) or pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE (titre 2.1 x 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: AAV-hSyn-DIO-mCherry (Addgene #50459-AAV8; 2,1.1013 vg/ml) was injected bilaterally into the DG of 10-week-old male PenkCre;Ai6 mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 200nL of AAV9-CaMKII-Cre (10^12 gcp/mL Addgene) was injected at a depth of 300µm in each craniotomies ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-Syn-GCaMP6m-RPL10a (1−1013 gc/mL; Addgene #158777) was injected into PM ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, 44362, vg/mL) or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-jGCamp7s (Addgene 104491, titer; 2.5 x1013 pfu/ml). AvilCreERT2 mice received a total volume of 20 ul of viral injection into the medial and left lobes of the livers ...
-
bioRxiv - Neuroscience 2024Quote: - AAV8 hSyn-DIO -mCherry (2.3 × 1013 gp/ml) (Addgene #50459)
-
bioRxiv - Neuroscience 2021Quote: ... Thirty seconds after introduction of the capillary tube 100 nl of rAAV-CAG-GFP (Addgene, 37825-AAVrg) was infused into the spinal cord over 2 minutes ...
-
bioRxiv - Genetics 2022Quote: ... The resulting 100-bp fragment was assembled into an AflII-linearized gRNA empty vector (Addgene, ID#41824) using the Infusion assembly protocol (TaKaRa Bio) ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were transfected with a mixture of 100 ng of plasmid encoding sgRNA (pRG2; Addgene #104174) and 100 ng of plasmid encoding SpCas9 (pRGEN-Cas9-CMV/T7-Puro-RFP ...
-
bioRxiv - Genetics 2020Quote: ... The yeast were then transformed with 100 ng of CRISPR-Swap plasmid (pFA0055-gCASS5a, Addgene plasmid # 131774) and 1 μg of DNA repair template amplified either from BY ...
-
bioRxiv - Genomics 2022Quote: ... The resulting 100-bp fragment was assembled into an AflII-linearized gRNA empty vector (Addgene, ID#41824) using the Infusion assembly protocol (TaKaRa Bio) ...
-
bioRxiv - Genetics 2023Quote: ... We used lentiviral vectors (100 MOI) designed explicitly for this purpose: lentiCRISPR v2-mCherry (Addgene plasmid # 99154), a gift from Agata Smogorzewska ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Bioengineering 2020Quote: ... pCXLE-hMLN and pCXLE-hOCT3/4 that were a gift from Shinya Yamanaka (Addgene plasmid # 27078, 27079 and 27076), according to previously reported papers(80,81) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) were transfected into HEK-293 T cells (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259)) were transfected into HEK-293 T cells (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446; http://n2t.net/addgene:17446; RRID: Addgene_17446). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...