Labshake search
Citations for Addgene :
751 - 800 of 3181 citations for 1 5 Bromo 1 2 Trimethylsilyl Ethoxy Methyl 1H Pyrrolo 2 3 B Pyridin 3 Yl Ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pMDG.2 (a gift from Didier Trono, Addgene #12559) and the lentiviral expression construct ...
-
bioRxiv - Genetics 2020Quote: ... and 2 µg of pMD2.G (Addgene, Cat# 12259)—using Lipofectamine (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) araC and PBAD from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg of pCMV6M-Pak1-WT (Addgene, 12209), pCMV6M-Pak1-T423E (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) AAV1.CAG.tdTomato (5.06×1012 GC/kg; Addgene #59462), 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-ef1a-fDIO-EYFP (Addgene 55641, titer 2×1011), AAVDJ-Ef1a-mCherry-IRES-cre (Addgene 55632 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMDG.2 (VSV-G expressor) and lentiCRISPRv2 (Addgene #52961) for generation of bulk PD-L2-KO cells or luciferase (Addgene #105621 ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Synthetic Biology 2022Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800 ...
-
bioRxiv - Pathology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (Addgene #141382)28 was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of pMtnA FLAG-IntS6 puro (Addgene #195076) or pMtnA FLAG-IntS12 puro (Addgene #195077 ...
-
bioRxiv - Cell Biology 2024Quote: ... the pMD2.G packaging plasmid (2 µg, Addgene, #12259), and 3X polyethylenimine was added dropwise to the culture and incubated for 18 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: Sequence encoding SARS-CoV-2 S protein (Addgene #164433) was a gift from Alejandro Balazs ...
-
bioRxiv - Microbiology 2024Quote: SARS-CoV-2 expression plasmids were acquired from Addgene, courtesy of the contribution from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(Y213A/I216A/W276A/I279A)-GFP (ΔLIR1+2) (RRID:Addgene_223782), BCL2L13(I224A/L227A/W276A/I279A)-GFP (ΔLIR1+3 ...
-
bioRxiv - Cell Biology 2024Quote: ... a mixture of 2 μg pMD2.G (Addgene #12259), 8 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... The pSIN-3×flag-ATF3 vector was derived from pSin-EF2-Nanog-Pur (#16578, Addgene). HEK293T cells were seeded so that cells density could be 80% confluence when it comes to transiently transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... with 3 µg of the episomal plasmid mix (equimolar mixture of plasmids obtained from Addgene: pCE-hOct3/4 ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were co-transfected with 3 plasmids: pAd-DELTA F6 (plasmid No. 112867; Addgene), serotype plasmid AAV PHP.eB ...
-
bioRxiv - Plant Biology 2023Quote: ... and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST) (pICH41421, Addgene #50339). As a batch calibrator ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: Unilateral stereotaxic injections of AAV5-CaMKIIα-EGFP (Addgene #50469; virus titer ≥ 3×10¹² vg/mL) and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Genetics 2023Quote: ... and 3’ extension oligos were cloned into the BsaI-digested pU6-pegRNA-GG- (Addgene #132777), pU6-tevopreQ1-GG- (Addgene #174038 ...
-
bioRxiv - Cancer Biology 2024Quote: ... EFEMP1 overexpression was achieved by transduced cells with FL-fibulin-3 pcDNA4 (Addgene, Plasmid 29700) (Hu et al ...
-
bioRxiv - Biochemistry 2024Quote: ... and ∼292 fmol ACTB-4xenv8-FL-3’antiPNA (as described previously,13 Addgene plasmid #112058), (1/2)NORAD-4xenv8-FL-3’antiPNA (Addgene plasmid #199208) ...
-
bioRxiv - Genetics 2024Quote: ... and cloned in to the eVLP backbone from pCMV-MMLVgag-3×NES-ABE8e (Addgene #181751) to replace the base editor ABE8e (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2024Quote: ... and NuMA-Cterm-5A-3) were cloned into a puromycin-resistant lentiviral vector (Addgene #114021). Lentivirus for each construct was produced in HEK293T cells that were purchased from ATCC (CRL-3216 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Neuroscience 2024Quote: ... The efficiency of viral-genetic receptor KO was established in an separate experimental cohort of Esr1loxP or PRloxP animals which received unilateral MPOA injections of either AAV2/5-CMV-EGFP-Cre (250 nl, Addgene 105545, 2 × 1013 GC / ml) or AAV2/5-CMV-EGFP (250 nl ...
-
bioRxiv - Bioengineering 2020Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene Plasmid #141184) and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183 ...
-
bioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163) and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164 ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids SARS-CoV-2 nsp10-His-3xFlag (Addgene ID 169162), SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163 ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159). To express nsp10-14 and nsp14-10 fusion proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... or 2) the depolarizing opsin Channelrhodopsin (AAV1.EF1a.DIO.hChR2.EYF; Addgene) was expressed in a cre-dependent manner in interneurons using Gad2-IRES-Cre C57BL/6J mice (Jackson Laboratory) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259) per well with LipoD293™ In Vitro DNA Transfection Reagent ...
-
bioRxiv - Genomics 2021Quote: ... 375 ng of Prime Editor-2 enzyme plasmid (Addgene #132776) and 125 ng of pegRNA plasmid were mixed and prepared with a transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... we used the 2-vector system (lenti-guide Puro; Addgene #1000000049 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... Sabatini lab (MIT) (Wang et al., 2; Addgene Catalogue # 51047). The libraries were amplified using published protocol at Addgene ...
-
bioRxiv - Immunology 2021Quote: ... and pcDNA 3.1-SARS-CoV-2 Spike (Addgene plasmid #145032) for 72 hours at 37°C under 5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... using pcDNA3-SARS-CoV-2-RBD-8his (Addgene #145145, (33)) as template ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of Gag and Pol (pMDLg/pRRE, Addgene #12251), and 2 μg of VSV-G envelope expressing plasmid (pMD2.G ...