Labshake search
Citations for Addgene :
701 - 750 of 980 citations for hsa mir 222 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... PCR was used to amplify the U6-crRNA scaffold and the DiCas7-11 gene sequence from pDF0114 (Addgene #172508) and pDF0159 (Addgene #172507) ...
-
bioRxiv - Bioengineering 2023Quote: ... The Sp sgRNA plasmids were obtained through PCR- site directed mutagenesis of p426- SNR52p-gRNA.CAN1.Y-SUP4t (Addgene 43803) to introduce the target sequences ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting pU6-chiRNA cassette was amplified by PCR and inserted into the pnos-Cas9-nos plasmid (Addgene #62208) at the NheI restriction site ...
-
bioRxiv - Biochemistry 2023Quote: ... This PCR product was digested with BamHI and BsrGI and cloned into pET-21a-PEmax-6His (Addgene plasmid #204471) digested with the same enzymes ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragment was subcloned in the BamHI and NotI site of pET-28a+GFP-CAMSAP1 CKK (Addgene #59033), which contains 6 histidine (His ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry ORFs were amplified by PCR using pFa6a-mEGFP-kanMX6 (a gift from Julien Berro72, Addgene plasmid # 87023), pAS1NB (a gift from Mark Prescott35 ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-APEX plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and APEX from pcDNA3 APEX-nes (Addgene) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: We PCR amplified Ecad using pEGFP-N1-Ecad plasmid [46] and V5-TurboID using mutant BirA R118S (TurboID) (Addgene [17]) using PCR primers (Table S4) ...
-
bioRxiv - Cell Biology 2020Quote: To generate MCP-NLS-2xYFP, we PCR amplified MCP from CYC1p-MCP-NLS-2xyeGFP (Tutucci et al., 2018) (Addgene #104394) using primer sequenc-es 5’-GAATTGCTCGAGGCCACCATGGCTTCTA-ACTTTACTCAGTTCG and 5’-CTCCGGCATCTAC-CCAAAAAAAAAAAGAAAAGTTATCGATATGG ...
-
Cytonemes coordinate asymmetric signaling and organization in the Drosophila muscle progenitor nichebioRxiv - Developmental Biology 2022Quote: ... The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR (Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB vector (Addgene). 5’HA-T2A-nls:Gal4:VP16-STOP-3’HA was assembled in correct 5’-to-3’ order between Not1 and EcoR1 sites of the pJet1.2 vector.
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2022Quote: ... a fragment containing the GIGYF2 sequence was obtained by PCR from the pcDNA4/TO/GFP-GIGYF2 vector (Addgene plasmid 141189) (34 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified PCR products were fused to biotin ligases via In-Fusion Recombination into myc-BioID2 pBabe (Addgene #80900; XhoI/PmeI), BioID2-HA pBabe (Addgene #120308 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sox2-t2A-mCherry was digested with XbaI and NheI to remove Sox2 and replace with PCR products from Nanog (Addgene plasmid # 59994 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sox2-t2A-GFP was then cut with KpnI and AgeI to remove GFP and replace with PCR-amplified mCherry from pAAVS1-NDi-CRISPRi (Addgene plasmid #73497 ...
-
bioRxiv - Cell Biology 2019Quote: ... the GFP coding sequence was amplified by PCR and inserted into pRS406-ADH1 (p406ADH1 was a gift from Nicolas Buchler & Fred Cross-Addgene plasmid # 15974 ...
-
bioRxiv - Molecular Biology 2019Quote: ... cerevisiae Sth1p bromodomain (residues 1250-1359) was generated by PCR from genomic DNA and cloned into a modified pGEX-4T1 vector (Addgene) using Ligation Independent Cloning (LIC) ...
-
bioRxiv - Cell Biology 2019Quote: The mCherry-DNKASH construct was made from the DNKASH-TSMod construct digested by AgeI/HpaI and mCherry from a PCR on a mCherry-cSrc construct (from M. Davidson, Florida State University, Tallahassee, FL; 55002; Addgene) (fwd ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid and cloning into the EGFP_SV40PA vector downstream of the OmEF1a promoter followed by the modified guide RNA scaffold sequence PCR amplified from gRNA_GFP-T2 (Addgene # 41820).
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplified products were cloned into BsmB1-digested LRG2.1 (a lentiviral sgRNA expression vector, U6-sgRNA-EFS-GFP, Addgene: 108098) using the Gibson Assembly kit (NEB#E2611) ...
-
bioRxiv - Cancer Biology 2019Quote: ... CDKN1A and NRF2 PCR amplicons were prepared with SpeI and MfeI restriction sites and cloned into pEN_TTmiRc2 BirA* (Addgene #136521). Luciferase PCR amplicon was prepared with SpeI and EcoRI restriction sites and cloned into pEN_TTmiRc2 3xFLAG digested with SpeI and MfeI sites (Addgene #136519) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and p53(R280K)-V5 PCR amplicon was prepared with SpeI and MfeI restriction sites and cloned into pEN_TTmiRc2 (Addgene #25752) digested with SpeI and MfeI (Addgene #136520 ...
-
bioRxiv - Neuroscience 2020Quote: ... BirA-HA and HaloTag constructs were PCR-amplified from pcDNA3.1-MCS-BirA(R118G)-HA (a gift from Kyle Roux, Addgene #36047) (Roux et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by digestion of the PCR product with EcoRI and SacII and ligation in between Smoothened and mCherry in mCherry-Smo (Addgene plasmid 55134 ...
-
bioRxiv - Cell Biology 2021Quote: GCaMP6m was generated by PCR amplifying the GCaMP6m sequence from pGP-CMV-GCaMP6m (Addgene plasmid #40754, (Chen et al., 2013)) and ligating it into the BamH1 and EcoR1 sites in pCS2+ ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral vectors were generated from Addgene plasmids #20297 and #50459 and titers determined via fluorometric quantification (Neuroscience Center Zurich) or by real-time quantitative PCR combined with SYBR green technology (Addgene). Respective titers were >9.1×1012 vector genomes/ml (Neuroscience Center Zurich ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The CyPet gene was amplified by PCR from the pCyPet-His vector (pCyPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14030 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The YPet gene was amplified by PCR from the pYPet-His vector (pYPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14031 ...
-
bioRxiv - Neuroscience 2020Quote: ... and jRGECO1a(Dana et al. 2016) were first amplified by PCR from pGP-CMV-GCaMP6f and pGP-CMV-NES-jRGECO1a (Addgene) with 5’ BamHI and 3’ HindIII ...
-
bioRxiv - Microbiology 2020Quote: PCR fragments corresponding to 231 nts of the Citrine coding sequence were amplified from ES-FUCCI plasmid (Addgene plasmid#62451) using primers containing T7 promoter sequence with 2 distinct PCR fragment allowing the positive-sense or negative-sense RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the overlapping PCR fragment method described in (Friedland et al. 2013) or were cloned into pDD162 (Addgene plasmid #47549) using the Q5 Site Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the p300 HAT core domain (p300 core) was PCR amplified from the pcDNA-dCas9-p300-Core vector (Addgene, Plasmid #61357) and cloned into MluI/BstXI digested pHR-TRE3G-KRAB-dCas9-P2A-mCherry backbone ...
-
bioRxiv - Molecular Biology 2019Quote: ... the KRAB sequence was PCR amplified from the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2A-Puro vector (Addgene, plasmid #71236) and cloned into the enCRISPRa sgRNA vector to replace VP64 ...
-
bioRxiv - Cell Biology 2019Quote: ... IRES DNA and mCherry cDNA were prepared by PCR using pEYFP SUMO-1 plasmid (from Mary Dasso: Addgene plasmid #13380), pWPI plasmid (from Didier Trono ...
-
bioRxiv - Synthetic Biology 2020Quote: Plasmids expressing dCas9-VPR were constructed by Isothermal assembly34 combining NotI linearized pMBO2744 attP vector backbone with dCas9-VPR PCR amplified from pAct:dCas9-VPR (Addgene #78898)35 and SV40 terminator for pH-Stinger (BDSC ...
-
bioRxiv - Cell Biology 2020Quote: ... we amplified two DNA fragments with PCR and used Gibson assembly to subclone these into the BamHI site of pBluescript II KS+ (Addgene). The first fragment ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293Ts were made to stably express doxycycline(dox)-inducible wild-type muSOX and its catalytically-dead D219A mutant by PCR amplifying the aforementioned coding sequences from Addgene plasmids 131702 and 131704 using the muSOX F/R primers (see Key Resources Table ...
-
bioRxiv - Synthetic Biology 2020Quote: ... moonbody (S5.1) cDNA was amplified via PCR and then inserted into the pSH-EFIRES-P-AtAFB2-mCherry vector (Addgene, #129716) between EcoRI and NotI sites to replace mCherry.
-
bioRxiv - Cell Biology 2021Quote: ... pRS315-NOP1pro-GFP1-10-mCherry-PUS1 and pRS315-NOP1pro-GFP1-10-mCherry-SCS2TM were generated using PCR products amplified from Addgene plasmids #86413 and #86419 and Addgene plasmids #86416 and #86419 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the genes of NIR-GECO(1,2,2G)-T2A-GFP and were constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of Cre was prepared by PCR and transferred to retroviral plasmid backbone (a gift from Fred Gage (Addgene plasmid # 49054 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pHCKan-yibDp-CBD-hGLY was constructed by DNA assembly with 2 PCR products amplified from (i) a plasmid coding hGLY under a T7 promoter (pHCKan-T7-CBD-hGLY, Addgene #134940 ...
-
bioRxiv - Genetics 2020Quote: ... of homology arms (∼400bp) PCR amplified from genomic DNA and the FKBP12F36V sequence amplified from plasmid pLEX_305-N-dTAG (Addgene # 91797) (Nabet et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Cell Biology 2021Quote: ... EGFP-Miro2 and mCherry-Miro1 were generated by PCR amplification of the coding sequence of Miro and ligated into pEGFP-C1(Addgene) or pmCherry-C1(Addgene) ...