Labshake search
Citations for Addgene :
701 - 750 of 1163 citations for Tumor Necrosis Factor Alpha Induced Protein 2 TNFAIP2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... and SNORD115 were designed using MIT’s CRISPR Design Tool (http://crispr.mit.edu; Supplemental Table 2) and cloned into pX459v2.0 (Addgene 62988) vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... or with 2 μg/ml puromycin (Gibco) (pTK93_Lifeact-mCherry; a gift from Iain Cheeseman, Addgene plasmid #46357) for 3 days ...
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Biophysics 2023Quote: ... pCAGGS-SARS-CoV-2 S D614G (# 156421) and pcDNA3.1 vectors were obtained from Addgene (Watertown, MA, USA), and Invitrogen (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The pDONR223-PRKCB2 (PKCβII, uniprot identifier: P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6×1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pCOLA-Gent-EM7-Erv1p-PDI were both cloned with 2 fragment gibson assemblies (Addgene Cat#202486). For each assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... and pICH51288 and pICH41414 (2×35S and 35S terminator; Addgene #50269 and #50337; Engler et al., 2014) in a BsaI Golden Gate reaction to generate binary vectors containing the fragment-swapped Rcr3/Pip1 hybrids driven by the double 35S CaMV promoter and targeted to the apoplast using a NtPR1a signal peptide ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid pLVX-EF1alpha-SARS-CoV-2-orf6-2xStrep-IRES-Puro (Addgene plasmid #141387 from Nevan Krogan) [12] was used for the overexpression of the accessory proteins ORF6 ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... MDA-LM2 and HCC1806-LM2 cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... The EGFP-TUBA1B fusion protein was subcloned into pDONR221 and was subsequently cloned into pLX303 (from David Root, Addgene #25897). CyclinB1-GFP was amplified using PCR (donor plasmid ...
-
bioRxiv - Cell Biology 2019Quote: ... pET-3d plasmid containing Chicken Capping Protein α1 and β1 subunits was a gift from John Cooper (Addgene plasmid #13451) The N-terminal domain of mouse CAP1 in pSUMOck4 was described earlier66.
-
bioRxiv - Microbiology 2021Quote: Mycobacterium marinum (ATCC 927) with the pTEC27 plasmid expressing the red fluorescent protein tdTomato (Addgene #30182, http://n2t.net/addgene:30182) (29 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... five nanoliters of a solution containing both sgRNAs at a concentration of 40 ng/μL and Cas9 protein (Addgene #47327) at a concentration of 250 ng/μL32 was injected into one-cell-stage medaka embryos ...
-
bioRxiv - Biochemistry 2022Quote: ... was made by ligating a PCR fragment encoding full-length human protein between ApaI and BamHI sites of pHis10-PS-SNAPf (75) (gift from Ron Vale; Addgene plasmid #78512 ...
-
bioRxiv - Neuroscience 2021Quote: ... the plasmid carrying spike protein sequence (Miaoling Plasmid Sharing Platform plasmid #P18156) was co-transfected with psPAX2 (Addgene plasmid #12260) into HEK293T cell line using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and TopBP1 was produced as a fused protein with a GST-tag (GST TopBP1 (aa 32-1522) His from Addgene; plasmid # 20375) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei of opsin-positive cells were visualized using a Histone2B fusion protein with mTFP1 (a gift from Robert Campbell & Michael Davidson; Addgene plasmid # 54553 ...
-
bioRxiv - Developmental Biology 2019Quote: The construction of a plasmid driving expression of green fluorescent protein (GFP) using a 1kb zebrafish αA-crystallin promoter was previously described [5] and the plasmid is available from Addgene. A second plasmid driving GFP expression with a 296 bp fragment of the human βB1 crystallin promoter was obtained from the Hall laboratory at the University of California at Irvine ...
-
bioRxiv - Biophysics 2019Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
-
bioRxiv - Bioengineering 2020Quote: Libraries of linear DNA fragments encoding variants of the designed proteins were transformed together with linearized pCTcon2 vector (Addgene #41843) based on the protocol previously described by Chao and colleagues (68) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A549 cells were retrovirally transduced with a construct coding for the N-terminus of 53BP1 fused to the sequence coding for fluorescent mCherry-protein (Addgene Catalog # 19835 ...
-
bioRxiv - Microbiology 2021Quote: ... Transfection efficiency was calculated by separately transfecting an enhanced green fluorescent protein (EGFP) expression plasmid pcDNA3-EGFP (pcDNA3-EGFP was a gift from Doug Golenbock (Addgene plasmid # 13031 ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus (AAV) vector expression imaging of enhanced green fluorescent proteins (eGFP): Stereotaxic injection of AAV8-CAG-GFP (Addgene ID ...
-
bioRxiv - Neuroscience 2020Quote: ... to label hyaluronic acid-based ECM we designed AAV expression vector carrying link protein hyaluronan and proteoglycan link protein 1 (HAPLN1, Gene ID: 12950) fused with mScarlet subcloned from the plasmid pCytERM_mScarlet_N1 (Addgene plasmid # 85066). Clones were verified by sequencing analysis and used for the production of adeno-associated particles as described previously (Mitlöhner et al ...
-
bioRxiv - Cell Biology 2021Quote: Rhodopsin protein was expressed in HEK293 cells using transient transfection (pcDNA3 rod opsin construct, a gift from Robert Lucas (Addgene plasmid # 109361 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified and cloned red shifted Luc gene downstream of MNDU3 promoter and linked via 2A peptide to florescent protein encoding gene which were amplified from Addgene plasmids 48249 (mWasabi) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Biochemistry 2022Quote: The pET28a plasmid vector containing DNA sequences encoding the PANK3 protein (residues pro12 to Asn368) was purchased from Addgene (25518) and transformed into both E ...
-
bioRxiv - Biochemistry 2021Quote: ... and all described mutants were independently cloned and expressed as a 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). These were cloned utilizing primers in Table S3 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV engineered for retrograde transport and carrying either tdTomato or green fluorescent protein (AddGene, AAVrg-CAG-tdTomato, AAVrg-CAG-GFP) in PBS was injected using a Nanoject II (Drummond ...