Labshake search
Citations for Addgene :
701 - 736 of 736 citations for Trefoil Factor 3 TFF3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: The HIV-derived construct pNL4-3(eGFP)(NL4-3 RRE)(TagBFP) (pHR5580) was packaged and VSV-G pseudotyped using a transient second generation packaging system including psPAX2 (Addgene plasmid 12260, pHR5691) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... containing 40bp of the 5’ end of cobK to a second 923-bp PCR-generated fragment (FR2) containing 107bp of the 3’ end of cobK in a three-way ligation reaction with p2NIL backbone (Addgene plasmid #20188; (46)) ...
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... and 80-100nl of either AAV5-hSyn-hChR2(H134R)-EYFP (UNC Vector core) or pAAV9-mDlx-ChR2-mCherry-Fishell-3 (Addgene viral prep # 83898) was injected into the right GPi or SNr ...
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.6-0.8 uL of a 1:1 mixture of GAD1-cre and mCherry virus (AAV8-hSyn-DIO-mCherry, ≥ 1×101 3 vg/mL; Addgene, Watertown, MA, USA) was injected bilaterally into VP ...
-
bioRxiv - Genetics 2024Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722, originally from 29). Library1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes with a total volume of 50 μl were prepared in milliQ H2O and contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 or rnt-1 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette attached to a 10μl Hamilton syringe was backfilled with a solution containing a viral construct carrying gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, titer 3×1013 gc/mL Addgene cat no 104488-AAV1). To reach the appropriate titer ...
-
bioRxiv - Bioengineering 2024Quote: ... Double-cysteine substitution variants of DoubleCatcher were derived from pDEST14-SpyCatcher003-(GSG)3-SpyCatcher003-TEVs-SpyTag003DA by Gibson assembly: DoubleCatcher α-Lock (GenBank and Addgene deposition in progress), DoubleCatcher β-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Molecular Biology 2019Quote: ... were cloned via BpiI into pX330S-2 and pX330S-3 (Sakuma et al., 2014) and a third vector pGEP179_pX330K (this study) according to kit instructions (Addgene Kit#1000000055, Sakuma et al., 2014). The pGEP179_pX330K plasmid is a modified entry vector generated by cloning the BsaI-pU6-sgRNA-BsaI fragment from pX330A-1×3 (Sakuma et ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and guide RNAs were cloned into plasmid pCFD3-dU6:3 (for Dlp, Mad and Med) or pCFD4-U6:1_U6:3 (for Babo, Brk, Dad, Sax, Shn, Smad2 and Wit) (Addgene #49410 and #49411, (Port et al., 2014)) ...
-
bioRxiv - Immunology 2024Quote: ... VDJ sequences were ordered from IDT and cloned into the vector AbVec antibodies (Addgene)
-
bioRxiv - Genetics 2020Quote: ... The C-terminal portion of the hygromycin resistance gene and the unc-54 3’ UTR were then independently amplified from pCFJ1663 (Addgene #514840 from the lab of Erik Jorgensen) and inserted into the SbfI site of pMS4 to create the final landing pad plasmids (pMS70-75) ...
-
bioRxiv - Bioengineering 2020Quote: ... Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned separately into the pHLsec mammalian expression vector (Addgene, #99845) via Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... the antibody component of the SunTag system (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS45, a gift from Ron Vale, Addgene #60904) was digested with EcoRI+NotI and subcloned into the blunted BamHi site of pCW-TRE ...
-
bioRxiv - Bioengineering 2023Quote: ... To generate the monoclonal IgG1 antibody CSL362 biosimilar MIRG123 the VH and VKL sequences were cloned into AbVec2.0-IGHG1 (Addgene plasmid # 80795) and AbVec1.1-IGKC (Addgene plasmid # 80796) ...
-
bioRxiv - Bioengineering 2024Quote: Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned individually into the pHLsec mammalian expression vector (Addgene, #99845) using Gibson assembly ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...