Labshake search
Citations for Addgene :
701 - 750 of 1404 citations for Recombinant Human ERBB2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
bioRxiv - Cell Biology 2023Quote: Coding sequence of human PITX2C (NM_000325.6) was cloned into lentivirus transfer plasmid (pWPI, Addgene#12254) using Gibson Assembly® kit (NEB ...
-
bioRxiv - Systems Biology 2022Quote: ... 240 million cells were transduced with lentivirus from the Human Genome-wide CRISPRi-v2 (Addgene #83969 ...
-
bioRxiv - Microbiology 2023Quote: ... Human codon-optimized full-length Eph receptors were subcloned from pDONR223-EphB1 (Addgene # 23930 (82)) ...
-
bioRxiv - Cancer Biology 2023Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Cancer Biology 2023Quote: ... we amplified mutant human HIF1/2α using the pcDNA3-HA-HIF1α(P402A/P564A) (Addgene #18955) plasmid and the pcDNA3-HA-HIF2α(P405A/P531A ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Microbiology 2023Quote: The human CUL1 and UBE2L3 coding sequences were amplified from pcDNA-HA-UBE2L3 (Addgene, #27561) and pcDNA-myc3-CUL1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220 ...
-
bioRxiv - Cancer Biology 2024Quote: The Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066)78 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first fragment was amplified using p15-Cam-F and p15-Cam-R (Table 1) from the plasmid pEVOL-pBpF (Addgene #31190), and the second fragment was obtained from the pBAD/HisB vector (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... or a human FIRRE cDNA plasmid (htransgene; Dharmacon BC03858) were each transfected together with the selectable marker pPGK-Puro plasmid (gift from R. Jaenisch; Addgene 11349) into ΔFirreXa cells using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... The Lenti-CMV-mCherry-P2A-CRE (aka pLM-CMV-R-Cre) plasmid was a gift from Michel Sadelain (Addgene plasmid #27546) (34) ...
-
bioRxiv - Cell Biology 2022Quote: ... T2A-GFP fragment was amplified by T2A-F and GFP-R primers using plenti-CMV-mCherry-T2A-GFP (Addgene plasmid #109427) as a template ...
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Cell Biology 2021Quote: ... Real time analysis of NFAT4-GFP nuclear translocation in response to 10 µM Cch stimulation was calculated using the equation: Quantification of ER Ca2+ store depletion and refilling was measured by transfecting parental and MCU-KO HEK293 cells with red R-CEPIA1er (Addgene: #58216) using Lipofectamine 24 hrs prior to imaging ...
-
bioRxiv - Biochemistry 2020Quote: D3cpV-px (PST 1738) was generated from (pcDNA-)D3cpV (kind gift from A. Palmer and R. Tsien (Palmer et al., 2006) (Addgene #36323)) by amplifying an insert with OST 1599 (GCGCATCGAT GGTGATGGCC AAGTAAACTA TGAAGAG ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 × 105 cells were resuspended in 10 μL of R-buffer with 0.5–2 μg of the EMTB 3x EGFP plasmid (a gift from William Bennett, Addgene plasmid 26741). Cells were exposed to three pulses of amplitude 1325 V and duration 10 ms in the electroporator ...
-
bioRxiv - Cell Biology 2022Quote: ... was amplified by PCR using oligonucleotide primers Pac1-paGFP-F (GGGTTAATTAACGTGAG-CAAGGGCGAGGAG) and Asc1-paGFP-R (AGTGGCGCGCCCTACTTGTACAGCTCGTCCATGCC) and the product was cloned into pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) digested with Pac1/Asc1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in transformed fibroblasts was achieved by transient expression of Cre recombinase by transfection with the plasmid pLM-CMV-R-Cre (Addgene, 27546), which codes for mCherry-Cre recombinase ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp12 protein was expressed from pFastBac vector 438C (Addgene #154759) in Hi5 insect cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Synthetic Biology 2020Quote: Expression vector encoding humanized pCas9_GFP protein was obtained from Addgene.org (Plasmid #44719) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Expression vectors encoding Anti-CRISPR proteins were obtained from Addgene: AcrIIA2 (pJH373 plasmid ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a green florescence protein (GFP) derived from pJL1 (Addgene #69496), and a C-terminal twin-strep-tag (66) ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Genetics 2020Quote: ... and a blue fluorescent protein (BFP) expression cassette (Addgene #36086). The 1kb upstream and 1kb downstream arms were amplified from purified mouse genome from AB2.2 ES cells (ATCC #SCRC-1023 ...
-
bioRxiv - Genomics 2021Quote: ... Protein A (pA) was amplified from pK19pA-MN (ASP4062, Addgene plasmid #86973 ...
-
bioRxiv - Microbiology 2022Quote: ... we also expressed WT and D614 S-protein-FLAG (Addgene plasmids 156420 and 156421 ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: Plasmids encoding fluorescent fusion protein were either purchased from Addgene or constructed in house using ligation (NEB Cat# M2200S ...
-
bioRxiv - Cell Biology 2023Quote: ... a monomeric red fluorescent protein (RFP)-FKBP12 (Addgene, Plasmid #67514) (71 ...
-
bioRxiv - Cell Biology 2023Quote: ... and enhanced green fluorescent protein (eGFP) (Addgene, Boston, MA, USA). Cells were nucleofected using the Amaxa 4D-Nucleofector (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... tropicalis proteins were cloned into the pHAT2 vector (Addgene #112583) using NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reference sgRNA library sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Genomics 2020Quote: Human iPSCs were dissociated to single cells and nucleofected with Cas9-coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid on Amaxa 4D-Nucleofactor program CA-137 (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... C domain coding sequences of human CRT were cloned into the pCMV vector (Addgene plasmid #59314) to generate recombinant constructs with C-terminal Human IgG1Fc (Ig ...
-
bioRxiv - Cancer Biology 2020Quote: ... then the human codon optimized Cas13a coding sequence amplified from the pC013-Twinstrep-SUMO-huLwCas13a (Addgene) by PCR was cloned into pMD19-T-DMP to obtain pMD19-T-DMP-Cas13a,next the chemically synthesized U6 promoter sequence and the direct repeat sequence of guide RNA of Cas13a separated by BbsI restriction sites were cloned into pMD19-T-DMP-Cas13a ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Molecular Biology 2022Quote: Genome-wide CRISPR screening was performed using the Human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048). For sgRNA library transduction ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids containing the coding sequences of human SLC46A1 (pDONR221_SLC46A1) and SLC46A3 (pDONR221_SLC46A3) were purchased from Addgene. Custom plasmids (pTwist-CMV ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309 ...