Labshake search
Citations for Addgene :
701 - 750 of 1958 citations for Mouse Anti Dengue Virus NS1 Serotype 1 Antibody BA11 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and residues 1-133 (Addgene #138422) were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19 ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-puro plasmids (Addgene #8453) were cloned as previously described (78) ...
-
bioRxiv - Genetics 2019Quote: ... catalytic active lipin 1 (Addgene #32007), pRK5 FLAG wildtype ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1 Scrambled shRNA (#1864, Addgene), pLKO.1 HIF2α shRNA (#TRCN0000082307 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-TRC (shSCR) (Addgene; 10879) was used as a control ...
-
bioRxiv - Microbiology 2020Quote: ... and AdEasier-1 cells (Addgene #16399) were a gift from Bert Vogelstein (He et al ...
-
bioRxiv - Biochemistry 2022Quote: ... cloned into pMSCVpuro (Addgene #K1062-1) at Hpa1 and EcoR1 sites to create pMSCVpuro-His-mCherry ...
-
bioRxiv - Plant Biology 2019Quote: ... pYLsgRNA-AtU6-1 (Addgene ID: 66202) or pYLsgRNA-AtU6-29 (Addgene ID ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Developmental Biology 2020Quote: ... pLKO.1-shSCR (Addgene, Plasmid #1864), was obtained from Addgene (Cambridge ...
-
bioRxiv - Microbiology 2022Quote: ... 1 -hygro vector (Addgene, plasmid #24150) was used to generate the pLKO.1-hygro-AMOTL1-sh construct ...
-
bioRxiv - Microbiology 2022Quote: ... psPAX2 (HIV-1 gag/pol) (Addgene) and pMD2.G (encoding VSV-G ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 µg psPAX2 (Addgene 12260) using PEI and following standard protocol.Viral supernatant was harvested after 60 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μg psPAX2 (Addgene 12260) using PEI and following standard protocol ...
-
bioRxiv - Immunology 2023Quote: ... pLKO.1 puro vector (Addgene, #8453) expressing control or Il5ra shRNAs ...
-
bioRxiv - Biochemistry 2023Quote: ... and PSPAX2 (1 μg, Addgene 12,260) in 600 μL per plate OPTIMEM and Lipofectamine 2000 transfection reagent (Invitrogen 11668027 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg pCXLE-hSK (Addgene #27078), and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg pMD2.G (AddGene G12259) and 3 μg psPAX2 (AddGene 12260 ...
-
bioRxiv - Molecular Biology 2023Quote: The pLKO.1 (Addgene plasmid #13425) lentiviral vector carrying the neomycin resistance gene was used to express shRNA sequences in targeted cells ...
-
bioRxiv - Biochemistry 2023Quote: ... pLenti-CMV-Hygro (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman) ...
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Genomics 2019Quote: ... pENTR4-GST 6P-1 (w487-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17741) (22) ...
-
bioRxiv - Neuroscience 2020Quote: ... Animals were infused bilaterally with 1 μl of AAV5-hSyn-DIO-hM4Di-mCherry (1012 particles.ml−1, Addgene, Watertown ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqp1a.1 or aqp8a.1 cDNA was subcloned into pmCherry-N1 or pEGFP-N1 vector (Addgene). Human retinal microvascular endothelial cells (HRMECs ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA sequences targeting LINE-1 ORF169 were cloned into pLKO.1-TRC cloning vector (Addgene, cat# 10878) using EcoR1 and AgeI restriction enzyme digestion ...
-
bioRxiv - Biochemistry 2022Quote: ... CRISPR sense and anti-sense guides were cloned into pX335 (Addgene plasmid 42335 ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry GST-tagged nanobodies (Addgene #70696, (Katoh et al, 2016)) were expressed and purified according to published protocol (Katoh et al. ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
bioRxiv - Neuroscience 2020Quote: ... a pan-neuronal AAV expressing EGFP (rAAV2/1.hSynapsin.EGFP.WPRE.bGH, Penn Vector Core, AV-1-PV1696, Addgene ID 105539) was used for stereotaxic injections into wildtype C57BL/6J mice ...
-
bioRxiv - Neuroscience 2020Quote: ... we used a Cre-dependent AAV vector that robustly expresses EGFP within the cytoplasm of Cre-expressing infected neurons (AAV2/1.pCAG.FLEX.EGFP.WPRE.bGH, Penn Vector Core, AV-1-ALL854, Addgene ID 51502).
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434; w785-1: Addgene plasmid #26730 ...
-
bioRxiv - Neuroscience 2019Quote: ... a pan-neuronal AAV expressing EGFP (rAAV2/1.hSynapsin.EGFP.WPRE.bGH, Penn Vector Core, AV-1-PV1696, Addgene ID 105539) was used for injections into wildtype C57BL/6J mice at postnatal day 56 (stock no ...
-
bioRxiv - Neuroscience 2022Quote: ... received 0.8 uL of a 1:1 mixture of AAV9-Syn-Flex-GCaMP6f (2.1 * 10^13 GC/mL; Addgene) and AAV8-GAD1-cre (8.29×10^13 GC/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scramble shRNA pLKO.1 vector (Addgene, 1864) was used as a control.
-
bioRxiv - Cell Biology 2020Quote: ... h-lin-28 and EBNA-1 (Addgene plasmids #27077 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 μg of psPAX2 (Addgene #12260), and with 21 μL of TransIT-Lenti (Mirus #6603) ...
-
bioRxiv - Genomics 2020Quote: ... and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...