Labshake search
Citations for Addgene :
701 - 750 of 2504 citations for Monoethyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5-EF1a-DIO-eYFP (1.0 × 10e13 GC/ml, Addgene) were injected into POm and S1 of Rbp4-cre mice ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV5-hSyn-eNpHR3.0-eYFP (2.3 × 10e12 GC/ml, Addgene) into the SP5i (AP -6.6 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1α-DIO-hM3Dq-mCherry (2.4×1012 vg/ml, Addgene plasmid #50460-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: AAV1-CAG.FLEX.GFPsm_myc.WPRE.SV40 (1.12E+13 GC/ml) was purchased from Addgene. EnvA+ RVdG-5PSD95eGFP-SynPhRFP (1.55E+08 IU/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Ef1a-DIO EYFP (∼1x1013 GC/ml, 300 nl, Addgene) was bilaterally injected into VTA and SN of 10 wk old mice ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV9.CAG.Flex.GCaMP6s.WPRE.SV40 (1.9 x 1013 vg/ml, Addgene) or pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE (titre 2.1 x 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: AAV-hSyn-DIO-mCherry (Addgene #50459-AAV8; 2,1.1013 vg/ml) was injected bilaterally into the DG of 10-week-old male PenkCre;Ai6 mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 200nL of AAV9-CaMKII-Cre (10^12 gcp/mL Addgene) was injected at a depth of 300µm in each craniotomies ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, 44362, vg/mL) or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-jGCamp7s (Addgene 104491, titer; 2.5 x1013 pfu/ml). AvilCreERT2 mice received a total volume of 20 ul of viral injection into the medial and left lobes of the livers ...
-
bioRxiv - Neuroscience 2024Quote: - AAV8 hSyn-DIO -mCherry (2.3 × 1013 gp/ml) (Addgene #50459)
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... Thirty seconds after introduction of the capillary tube 100 nl of rAAV-CAG-GFP (Addgene, 37825-AAVrg) was infused into the spinal cord over 2 minutes ...
-
bioRxiv - Genetics 2022Quote: ... The resulting 100-bp fragment was assembled into an AflII-linearized gRNA empty vector (Addgene, ID#41824) using the Infusion assembly protocol (TaKaRa Bio) ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were transfected with a mixture of 100 ng of plasmid encoding sgRNA (pRG2; Addgene #104174) and 100 ng of plasmid encoding SpCas9 (pRGEN-Cas9-CMV/T7-Puro-RFP ...
-
bioRxiv - Genetics 2020Quote: ... The yeast were then transformed with 100 ng of CRISPR-Swap plasmid (pFA0055-gCASS5a, Addgene plasmid # 131774) and 1 μg of DNA repair template amplified either from BY ...
-
bioRxiv - Genomics 2022Quote: ... The resulting 100-bp fragment was assembled into an AflII-linearized gRNA empty vector (Addgene, ID#41824) using the Infusion assembly protocol (TaKaRa Bio) ...
-
bioRxiv - Genetics 2023Quote: ... We used lentiviral vectors (100 MOI) designed explicitly for this purpose: lentiCRISPR v2-mCherry (Addgene plasmid # 99154), a gift from Agata Smogorzewska ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... and a 1:1 solution of AAV1.Syn.GCaMP6f.WPRE.SV40 (Addgene) and AAV1.mDlx.GFP-GCaMP6f-Fishell-2.WPRE.SV40 (Penn Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1 mixture of pENN.AAV.CamKII 0.4.Cre.SV40(AAV1; Addgene #105558 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138) containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... we used an existing CMV-driven SARS-CoV-2 plasmid (pcDNA3.1-SARS2-Spike, Addgene 145032)(Shang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Cell Biology 2019Quote: ... the guide RNA sequence (Supplemental Item 2) was cloned into the PX330 plasmid (Addgene #42230), which expresses S ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Microbiology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (a gift from Nevan Krogan, Addgene plasmid # 141382) was used to express S-protein from the original SARS-CoV-2 strain (WT) ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Molecular Biology 2023Quote: 2 µg total of multiplex sgRNA vector and EF1α-dCas9-VPR-Puro vector (Addgene #99373) at a 2:1 molar ratio were mixed with 5 µl of Lipofectamine 2000 (Thermo ...
-
bioRxiv - Biophysics 2022Quote: SARS-CoV-2 S HexaPro plasmid was a gift from Jason McLellan (Addgene plasmid # 154754). This plasmid contains CMF promotor driven expression of the SARS-COV-2 Spike-B.1 ectodomain (1-1208 AAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genomics 2023Quote: ... guide pair 2: TTGCGGCGCTGTGGCGCCGA and CGCTCCCGCAAGTGGATGTC) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described [49] ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected organoids for 2 weeks with the AAV1-hSYN-eGFP virus (Addgene, 105539-AAV1), which directs expression of eGFP under the neuron-specific synapsin promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... pEvol-pAzFRS.2.t1 was a gift from Farren Isaacs [Amiram et al 2017] (Addgene plasmid # 73546 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA sequences (Extended Data Table 2) were inserted into the pDD162 vector (Addgene #47549) by linearizing the vector with 15 base pairs (bp ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were co-transfected with 2 μg lentivirus packaging plasmids (pMD2.G (Addgene #12259) and 10 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2024Quote: Neurogenin 2 (NGN2) was expressed in iPSC lines using a tetracycline inducible promoter (Addgene 172115) integrated using Piggybac plasmid EFa1-Transposase (Addgene plasmid 172116 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2-hsyn-hM3Dq-mCherry (Addgene #50474-AAV2; 7.38 ×1012 vg/ml) was injected into the bilateral sensorimotor cortex at four sites (500 nL/point ...