Labshake search
Citations for Addgene :
701 - 750 of 1474 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human LOXL2 was amplified from plasmid pQXCINeo-LOXL2-BC [bought from Addgene, catalog number #134763] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human TG2 was amplified from plasmid W118-1_hTGM2-Flag [bought from Addgene, catalog number #180407] ...
-
bioRxiv - Neuroscience 2024Quote: ... amplifying the human fragment from GLP1R-tango (plasmid from Addgene, #66295, RRID:Addgene_66295), including the leader sequence present in the GLP1R-tango ...
-
bioRxiv - Neuroscience 2024Quote: ... amplifying the human fragment from GLP1R-tango (plasmid from Addgene, #66295, RRID:Addgene_66295), including the leader sequence present in the GLP1R-tango ...
-
bioRxiv - Biophysics 2024Quote: ... The human UBA1 and UBA7 genes were obtained from Addgene (34965, 12438). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... we inserted human LC3/GBRP cDNA in a pGEX-4T1 vector (RRID:Addgene_223726 ...
-
bioRxiv - Biochemistry 2020Quote: HEK293T CRISPR-Cas9 cells were generated by transfecting wild-type 293T cells with pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene, Plasmid# 42230) carrying single-guide RNA (sgRNA ...
-
bioRxiv - Cancer Biology 2022Quote: MIA PaCa-2 wild type (WT) and TSC1/TSC2 knockout (KO) cells were transduced with retrovirus expressing RFP (pQCXIP-turboRFP, Addgene #73016) or EGFP (pQCXIP-EGFP-F ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...
-
bioRxiv - Immunology 2024Quote: ... The construction of Traf3 (both wild type and mutants) was achieved by digestion of pmir-PGLO vector (Addgene, Watertown, MA, USA) with double restriction enzymes (Xhol I and Xbal I) ...
-
bioRxiv - Cancer Biology 2024Quote: pBABE-Puro retroviral vector (EV) and pBABE-Puro vectors carrying ERBB2 wild-type and mutants were co-transfected independently with pUMVC (Addgene #8449) and VSV-G (Addgene #8454 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Genomics 2021Quote: Individual effectors were fused at the N-terminus to the PYL1 domain (gift from Jerry Crabtree, Addgene plasmid #38247) and sfGFP ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521; http://n2t.net/addgene:12521; RRID: Addgene_12521). The pLPC-puro-N-Flag-NELFE plasmid was obtained by amplification of the human NELFE cDNA (obtained from gene synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pGL3-U6-sgRNA-PGK-puromycin and pST1374-N-NLS-flag-linker-Cas9-D10A were gifts from Xingxu Huang (Addgene plasmid # 51133 ...
-
bioRxiv - Biochemistry 2021Quote: ... Jürg Müller (for generation of pcDNA5.1-FRT/TO-puro-(N)GFP-TEV-FLAG-3C-BAP1) or originated from Wade Harper’s laboratory obtained from Addgene (for generation of pcDNA5-FRT/TO-puro-eGFP-BAP1) ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats intended for fiber photometry experiments (n=11 females) received unilateral infusions of AAV9 FLEX-GCaMP6f (0.4uL, titer ∼1.4 × 1013 GC/mL, Addgene #100833) into the VP and retro-AAV Cre (0.4uL ...
-
bioRxiv - Physiology 2024Quote: ... the AAV9-TNT-MCM2 vector was created by amplifying MCM2 cDNA from mEmerald-MCM2- N-22 (Addgene ID: 54164) using forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...