Labshake search
Citations for Addgene :
701 - 724 of 724 citations for Corticosterone ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... was digested with NheI/KpnI and ligated with similarly digested pPD96.52 (Fire lab C. elegans Vector Kit 1999; 1608: L2534, Addgene) to generate pKMC166 (myo-3p::mCherry) ...
-
bioRxiv - Plant Biology 2022Quote: ... p35S:MPTMV-YFP + ERmCherry and p35S:MPToBRFV-YFP + ER-mCherry were assembled by Golden Gate cloning using the MoClo tool kit for plants (Addgene) (Weber et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... a region extending from the gene upstream of the transcription start site of a candidate gene plus the first exon and intron of that gene was fused to the sequence of GFP in plasmid pPD95.75 (Fire Vector kit, Addgene) which also contains the unc-54 3’UTR ...
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Cell Biology 2023Quote: ... Targeting sequence was cloned into pDD162 plasmid by using NEB’s Q5 Site-Directed Mutagenesis Kit to insert the targeting sequence into our Cas9-sgRNA construct (Addgene #47549) by using forward primer 5’-(CAAGCGAAAGAGTCGTCGAA)GTTTTAGAGCTAGAAATAGCAAGT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... TALENs were constructed according to the instruction provided by the TALE Toolbox kit from the Zhang laboratory (Sanjana et al., 2012) (Addgene, #1000000019). The target sequences for the left arm ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Genetics 2020Quote: ... The same kit was used to produce Cas9 D10A mRNA using as template the plasmid pCAG-T3-hCasD10A-pA (Addgene #51638). The 140bp ssDNA homology direct repair (HDR ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: GPCR coding sequences were provided by Bryan Roth (University of North Carolina, Chapel Hill, NC; PRESTO-Tango Kit—#1000000068, Addgene, Watertown), MA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: GPCR coding sequences were provided by Bryan Roth (University of North Carolina, Chapel Hill, NC; PRESTO-Tango Kit - #1000000068, Addgene, Watertown), MA ...
-
bioRxiv - Developmental Biology 2021Quote: Minos transposase mRNA was generated using the ThermoFisher mMESSAGE mMACHINE T7 or T7 ULTRA kit using NotI-digested pBlueSK-MimRNA (Addgene #102535). mRNA and concentrated DNA were mixed into a final concentration of 1 µg/µL in a solution of 0.1% phenol red in nuclease-free water ...
-
bioRxiv - Developmental Biology 2021Quote: ... were designed on ZiFiT (http://zifit.partners.org/ZiFiT/) and constructed using the Joung Lab REAL Assembly TALEN kit (a gift from Keith Joung; Addgene, Cambridge, MA, #1000000017), according to the provided protocol (Sander et al. ...
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Genomics 2020Quote: The CRISPR/Cas9 plasmid (CTCF-mouse-3sgRNA-CRISPRexp-AID) was assembled using the Multiplex CRISPR/Cas9 Assembly System kit57 (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized ...
-
bioRxiv - Genetics 2019Quote: ... Capped Cas9 mRNA was created by in vitro transcription using Thermo Fisher mMESSAGE mMACHINE™ SP6 Transcription Kit from pCS2-nls-zCas9-nls (Addgene#47929)
-
bioRxiv - Cancer Biology 2019Quote: ... and Gus (which is included in the BP reaction kit) were subcloned into the pLX301 vector (from David Root, Addgene plasmid #25895) using the Gateway LR Clonase II Enzyme mix from ThermoFisher (#11791020) ...
-
bioRxiv - Neuroscience 2020Quote: ... TAL effector modules were assembled and cloned into the array plasmids pFUS using the Golden Gate TALEN and TAL Effector kit (Addgene, Cambridge, USA) according to validated procedure (Cermak et al. ...
-
bioRxiv - Immunology 2020Quote: ... DT40 CL18 Fam72a−/− cells were obtained by transfecting DT40 CL18 with Nucleofector™ Kit V four constructs in PX458 (Addgene, plasmid #48138) targeting Fam72a (1.5μg each ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Component vectors containing markers and connectors used to construct cloning vectors using this standard were a gift from John Dueber distributed through (Kit # 1000000061, Addgene, Watertown, U.S.A.). The genes or gene fragments were cloned into the storage vector pYTK001 using a Golden Gate assembly with BsmBI ...
-
bioRxiv - Biochemistry 2022Quote: ... The HTT expression constructs were assembled using the BD In-Fusion PCR cloning kit in the mammalian/insect cell vector pBMDEL (Addgene plasmid #111751), an unencumbered vector created for open distribution of these reagents.
-
bioRxiv - Synthetic Biology 2022Quote: ... All plasmids in this study were constructed using Golden Gate Assembly (Engler et al., 2008) and formatted with the Yeast MoClo Toolkit (Lee et al., 2015) (Addgene Kit #1000000061). ORFs encoding previously described zinc finger and clamp proteins (Bashor et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...