Labshake search
Citations for Addgene :
701 - 750 of 1104 citations for 7 Trifluoromethyl quinazoline 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV; RRID: Addgene_17446)] at a multiplicity of infection of 10 with 8 μg/mL polybrene (hexadimethrine bromide [Cat # 107689 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Immunology 2019Quote: ... or VPR WT or a Q65R VPR mutant were produced through co-transfection of 293T cells with 4 plasmids coding for Gag/Pol (Addgene #12251), Rev (Addgene #12253) ...
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076], pCXLE-hSK [Addgene #27078], pCXLE-hUL [Addgene #27080]) with 10ug of each plasmid through the Amaxa Nucleofector (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The patient-specific iPSCs were generated from LCLs by transfection with a combination of episomal plasmids (pCE-hOCT3/4, pCE-hSK, pCE-hUL, and pCE-mp53DD) (Addgene Inc.), as previously reported (Barrett et al ...
-
bioRxiv - Biophysics 2020Quote: ... A homozygous clone that passed all QC (U2OS HP1⍺ 4) was co-transfected with the transposon vector pEF1a-OsTIR-IRES-NEO-pA-T2BH (Addgene 127910) and SB100X in pCAG globin pA (Addgene 127909) ...
-
bioRxiv - Biochemistry 2022Quote: ... All plasmids generated by this study have been deposited to Addgene for distribution (See Supplemental Table 4 for Addgene accession numbers).
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2019Quote: ... and at 28°C for 4 hours if using a temperature-sensitive plasmid (pIMAY, gift from Tim Foster, Addgene plasmid # 68939) (Lee et al. ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Retrovirus expressing NFAT1-GFP was constructed by inserting BglII/HpaI NFAT1-GFP fragment from HA-NFAT1(4-460)-GFP plasmid (Addgene #11107) into BglII/HpaI sites of pMSCV-Blasticidin plasmid (addgene #75085 ...