Labshake search
Citations for Addgene :
651 - 700 of 1014 citations for rno mir 101a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: GCaMP6m was generated by PCR amplifying the GCaMP6m sequence from pGP-CMV-GCaMP6m (Addgene plasmid #40754, (Chen et al., 2013)) and ligating it into the BamH1 and EcoR1 sites in pCS2+ ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The CyPet gene was amplified by PCR from the pCyPet-His vector (pCyPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14030 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The YPet gene was amplified by PCR from the pYPet-His vector (pYPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14031 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2020Quote: ... and jRGECO1a(Dana et al. 2016) were first amplified by PCR from pGP-CMV-GCaMP6f and pGP-CMV-NES-jRGECO1a (Addgene) with 5’ BamHI and 3’ HindIII ...
-
bioRxiv - Microbiology 2020Quote: PCR fragments corresponding to 231 nts of the Citrine coding sequence were amplified from ES-FUCCI plasmid (Addgene plasmid#62451) using primers containing T7 promoter sequence with 2 distinct PCR fragment allowing the positive-sense or negative-sense RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the overlapping PCR fragment method described in (Friedland et al. 2013) or were cloned into pDD162 (Addgene plasmid #47549) using the Q5 Site Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the p300 HAT core domain (p300 core) was PCR amplified from the pcDNA-dCas9-p300-Core vector (Addgene, Plasmid #61357) and cloned into MluI/BstXI digested pHR-TRE3G-KRAB-dCas9-P2A-mCherry backbone ...
-
bioRxiv - Molecular Biology 2019Quote: ... the KRAB sequence was PCR amplified from the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2A-Puro vector (Addgene, plasmid #71236) and cloned into the enCRISPRa sgRNA vector to replace VP64 ...
-
bioRxiv - Cell Biology 2019Quote: ... IRES DNA and mCherry cDNA were prepared by PCR using pEYFP SUMO-1 plasmid (from Mary Dasso: Addgene plasmid #13380), pWPI plasmid (from Didier Trono ...
-
bioRxiv - Synthetic Biology 2020Quote: Plasmids expressing dCas9-VPR were constructed by Isothermal assembly34 combining NotI linearized pMBO2744 attP vector backbone with dCas9-VPR PCR amplified from pAct:dCas9-VPR (Addgene #78898)35 and SV40 terminator for pH-Stinger (BDSC ...
-
bioRxiv - Cell Biology 2020Quote: ... we amplified two DNA fragments with PCR and used Gibson assembly to subclone these into the BamHI site of pBluescript II KS+ (Addgene). The first fragment ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293Ts were made to stably express doxycycline(dox)-inducible wild-type muSOX and its catalytically-dead D219A mutant by PCR amplifying the aforementioned coding sequences from Addgene plasmids 131702 and 131704 using the muSOX F/R primers (see Key Resources Table ...
-
bioRxiv - Synthetic Biology 2020Quote: ... moonbody (S5.1) cDNA was amplified via PCR and then inserted into the pSH-EFIRES-P-AtAFB2-mCherry vector (Addgene, #129716) between EcoRI and NotI sites to replace mCherry.
-
bioRxiv - Cell Biology 2021Quote: ... pRS315-NOP1pro-GFP1-10-mCherry-PUS1 and pRS315-NOP1pro-GFP1-10-mCherry-SCS2TM were generated using PCR products amplified from Addgene plasmids #86413 and #86419 and Addgene plasmids #86416 and #86419 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the genes of NIR-GECO(1,2,2G)-T2A-GFP and were constructed using overlap-extension PCR followed by subcloning into pAAV-CAG vector (Addgene no. 108420) using BamHI and EcoRI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of Cre was prepared by PCR and transferred to retroviral plasmid backbone (a gift from Fred Gage (Addgene plasmid # 49054 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pHCKan-yibDp-CBD-hGLY was constructed by DNA assembly with 2 PCR products amplified from (i) a plasmid coding hGLY under a T7 promoter (pHCKan-T7-CBD-hGLY, Addgene #134940 ...
-
bioRxiv - Genetics 2020Quote: ... of homology arms (∼400bp) PCR amplified from genomic DNA and the FKBP12F36V sequence amplified from plasmid pLEX_305-N-dTAG (Addgene # 91797) (Nabet et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Cell Biology 2021Quote: ... EGFP-Miro2 and mCherry-Miro1 were generated by PCR amplification of the coding sequence of Miro and ligated into pEGFP-C1(Addgene) or pmCherry-C1(Addgene) ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Biochemistry 2021Quote: ... the vector backbone was PCR-amplified and the resulting fragment was ligated with the ccdB kill-cassette excised from pINIT_cat (Addgene #46858) with SapI ...
-
bioRxiv - Cell Biology 2021Quote: ... T7 promoter was added to the Cas9 coding region and sgRNA-scaffold by PCR amplification of plasmid PX330 (Addgene, #42230). PCR products of Cas9 and sgRNA region were used for IVT by following the manufactural of mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... A cpGFP cassette was amplified by PCR from a pCDNA3.1 plasmid encoding ASAP1 (a gift from Dr. Michael Lin, Stanford, available as Addgene #52519) and inserted into pCDNA3.1-GPR68 using the NEBuilder HiFi DNA Assembly kit (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: The lentiviral dCas9 expression plasmid (lenti-dCas9-Blast) was generated by PCR-based mutagenesis of lentiCas9-Blast plasmid (Addgene #52962). Clover fused with PUF RNA-binding domain were previously described ...
-
bioRxiv - Cell Biology 2021Quote: The EB1-GFP lentivirus expression construct was made by PCR amplification of EB1-GFP from pEGFP N1 EB1-GFP (JB131) (gift from Tim Mitchison & Jennifer Tirnauer (Addgene plasmid # 39299 ...
-
bioRxiv - Neuroscience 2020Quote: All constructs containing the N/Q-rich region of the neuronal-specific Aplysia CPEB (residues 1-160) were cloned by PCR using a full-length clone (Addgene) as the template ...
-
bioRxiv - Molecular Biology 2021Quote: ... and its RdRp domain (aa 91-610) were obtained using PCR on a SINV cDNA plasmid template (pSIN ReP5-GFP-GluR1 from Addgene). The PCR fragments were subcloned into the pSUMO-LIC vector using a ligation-independent cloning method in which the expressed recombinant protein had an N-terminal hexahistidine-linked small ubiquitin-like modifier protein (His6-SUMO ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were co-transfected with two gRNA transcriptional cassettes prepared by PCR and CAG-Cas9-T2A-EGFP plasmid (Addgene #7831) as described elsewhere56 ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... After digestion with EcoRI and AgeI the PCR products were ligated into the pLVX-TetOne-Puro vector (Addgene plasmid #124797).
-
bioRxiv - Cell Biology 2022Quote: The mat-Gal4-sqhUTR plasmid was generated by PCR amplification of the Gal4 coding sequence from pPac-Pl-mCD8-D2A-Gal4 (a gift from Benjamin White, Addgene plasmid # 39457 ...
-
bioRxiv - Physiology 2022Quote: ... an mCherry-T2A-hM4Dinrxn cassette was PCR-amplified using CAG::mCherry-2a-hM4Dnrxn (Addgene #52523, donated by Dr. Scott Sternson) as a template with primers containing 5’-BamHI site and 3’-MluI site and then inserted into pENTR1A-TRE ...
-
bioRxiv - Physiology 2022Quote: ... an hM3Dq-mCherry cassette was PCR-amplified using pAAV-hSyn-DIO-hM3Dq-mCherry (Addgene #44361, donated by Dr. Bryan Roth) as a template with primers containing 5’-MluI site and 3’-EcoRI site and then inserted into pENTR1A-TRE between the MluI/EcoRI sites ...
-
bioRxiv - Plant Biology 2023Quote: ... BsaI recognition site and compatible vector overhang was used to generate specific gRNA amplicons by PCR from an gRNA scaffold template (AddGene no ...
-
bioRxiv - Genomics 2022Quote: The PCR product was cloned into the pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 vector (Addgene #6125554) using HindIII and XbaI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: Full length human TAOK1 was obtained from Transomics Technologies in PCR-XL-Topo plasmid and inserted into sfGFP-C1 (Plasmid #54579, Addgene), using the EcoRI and MfeI sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs encoding cyclin D1 WT and cyclin D1 (T286A) were PCR amplified from pcDNA cyclinD1 HA and pcDNA cyclinD1 HA T286A (Addgene plasmids #11181 and # 11182 ...
-
bioRxiv - Microbiology 2022Quote: UAS-SARS-CoV-2-ORF3a transgenic flies were generated by PCR-mediated subcloning of the SARS-CoV-2-ORF3a coding sequence (pDONR207-SARS-CoV-2 ORF3a, #141271, Addgene) into pUASt-Attb (EcoRI/XbaI) ...
-
bioRxiv - Microbiology 2024Quote: ... 782 bp PCR product obtained with primers ymCherryU and ymCherryL and pAG426-GAL-ccdb-ymCherry (a gift from Susan Lindquist (Addgene plasmid # 14155 ...
-
bioRxiv - Cell Biology 2024Quote: The coding sequence of APEX2 was PCR-amplified from APEX2 plasmid (a gift from Alice Ting, Addgene plasmid #72480, [86]) using specific primers containing restriction sites NotI (5’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... the FRT-STOP-FRT cassette sequence was PCR amplified from pJFRC201-10xUAS-FRT-STOP-FRT-myr::smGFP-HA (#63166; Addgene). The coding sequence of mCD8::DQVD/A was PCR-amplified from the genomic DNA of Caspase-Sensitive/Insensitive-Gal4 [20] ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding sequence of mNeonGreen was PCR-amplified from pAc5-V5::mNeonGreen [17] and ligated into the EcoRI-digested pQUAST (#24349, Addgene) vector using In-Fusion ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Microbiology 2023Quote: The construct pFUS ΔIDR-YFP was created by PCR amplifying the fus gene from pGST- TEV-FUS (a kind gift from Dr. Aaron Gitler; Addgene plasmid # 29629 ...
-
bioRxiv - Neuroscience 2023Quote: ... sfGFP genes were amplified by PCR from pJT119b plasmid which was kindly gifted by by Jeffrey Tabor (Addgene plasmid #50551), and cloned into pETcon-alpha syn ...
-
bioRxiv - Cell Biology 2023Quote: ... Obtained pcDNA-Halo was further digested with HindIII/Bam-HI restriction enzymes and ligated with the NPM insert (obtained by PCR amplification from eGFP-NPM (17578 Addgene) with our primers 5’-CCCAAGCTTCCACCATGGAAGATTCGATGGACATGG-3’ and 5’-CGGGATCCAAGAGACTTCCTCCACTGCC-3’ ...