Labshake search
Citations for Addgene :
651 - 700 of 846 citations for Zika Virus NS1 Proteins Uganda Suriname Strains Duo Pack since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Of the following vectors the fluorescent protein was exchanged for Tq-Ca-FLITS: 3xnls-mTurquoise2 (Addgene plasmid #98817) for a nuclear tag ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding TDP-43-MBP-His6 for bacterial protein expression was a gift from Nicolas Fawzi (Addgene plasmid #104480 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding TDP-43-MBP-His6 for bacterial protein expression was a gift from Nicolas Fawzi (Addgene plasmid #104480; http://n2t.net/addgene:104480; RRID:Addgene_104480) (38) ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCh-hRab7A (#922) plasmid encoding mCherry-labeled version of human Rab7A protein was from Addgene (Cat# 61804). GFP-hRab5A.dn3 (#966) ...
-
bioRxiv - Cell Biology 2021Quote: The RFP-hRab5A.dn3 (#921) plasmid encoding RFP-labeled version of human Rab5A protein was from Addgene (Cat# 14437). The mCh-hRab7A (#922 ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757; http://n2t.net/addgene:70757; RRID:Addgene_70757) (69) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033; http://n2t.net/addgene:13033; RRID:Addgene_13033). Plasmid pcDNA3-YFP-APE1 (for WT YFP-APE1 protein ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ; http://n2t.net/addgene:167585 ; RRID:Addgene_167585).
-
bioRxiv - Cell Biology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486; http://n2t.net/addgene:72486;RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Neuroscience 2023Quote: ... were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008, Addgene) used as a backbone after excising axonGCaMP6s by BamHΙ and NheΙ ...
-
bioRxiv - Physiology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486; http://n2t.net/addgene:72486; RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Developmental Biology 2023Quote: ... The protein coding sequence of Lck-GFP was amplified from the Lck-GFP plasmid (Catalog no.61099, Addgene) using Phusion high fidelity polymerase (Catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... together with an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene plasmid no. 8454), an expression vector for GAG-Pol-Rev (psPAX2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP, subcloned into pCAG from Addgene #89446) plasmids to 3.5 µg/µL in molecular grade ddH2O with 5% sucrose and 0.1% Fast Green FCF ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The SNAP protein was amplified from the DNA-CARzeta-GFP plasmid (a gift from Ron Vale, Addgene # 89344). The monomeric streptavidin (mSA) ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Cell Biology 2024Quote: ... We next used the human EZH2 primary protein sequence available in the addgene for hEZH2 plasmid (#24230, Addgene) and predicted the possible cysteine residues using the GPS-SNO prediction tools ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmids for expression of lipid anchored fluorescent proteins were obtained from the Addgene repository: MyrPalm-CFP (Addgene #14867) and MyrPalm-GFP (#21037) ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Immunology 2022Quote: A lentivirus expressing the ASC-GFP fusion protein was prepared by transfection of pLEX-MCS-ASC-GFP (Addgene 73957), psPAX2 ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The negative transcriptional feedback circuit used for the experiment contained a transcriptional repressor protein TetR expressed under a self-repressible promoter (Addgene plasmid # 45774; http://n2t.net/addgene:45774; RRID:Addgene 45774). TetR was fused to the green fluorescent protein variant deGFP and measured using excitation and emission at wavelengths 485 nm and 525 nm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Microbiology 2021Quote: ... GFP-LMP2 and mStrawberry-Ub fusion proteins were constructed by transfecting hBMECs with pBABEpuro LC3-GFP vector (Addgene, 22405), pMRX-IRES-GFP-LMP2 (GFP-LMP2 was subcloned from pCND3-GFP-LMP2 ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... The constructs were provided with a packaging vector (Pax2, 12.5 µg) and the envelope protein VSV-G (3.3 µg, Addgene, #8454) in Opti-MEM medium to which the transfection reagent Polyethylenimine (1 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... that have reached ~80-90% confluency with the second generation pHR plasmid carrying the desired transgene (Supplementary Table S2) and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: CTLs were transiently transfected with the pEGFP plasmid encoding the EB1-GFP fusion protein (Addgene #17234, Watertown, Massachusetts, USA). Briefly ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... DNA encoding the indicated proteins were inserted between the attR recombination sites and shuttled into modified pLEX_307 vectors (Addgene) using Gateway technology (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: Fusion protein expression cassettes were cloned into the lentiviral expression vector LeGO-G2 (kind gift from Boris Fehse, Addgene plasmid #251917 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus were packaged by co-transfection of the transfer plasmid encoding the protein of interest with psPAX2 (Addgene #12260) and pVSVG (Addgene # 35616 ...
-
bioRxiv - Bioengineering 2023Quote: ... by transfection with the lentiviral transfer vector plasmid (pWPI) that contains enhanced green fluorescent protein (eGFP) (Addgene plasmid # 12254), and provided by Dr ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Neuroscience 2023Quote: We transiently expressed the phototoxic KillerRed protein in Tg(SAIG213A:EGFP) fish by injecting a plasmid expressing KillerRed driven by UAS promoter (Addgene plasmid # 115516 ...