Labshake search
Citations for Addgene :
651 - 700 of 845 citations for Zika Virus NS1 Protein Suriname Strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding TDP-43-MBP-His6 for bacterial protein expression was a gift from Nicolas Fawzi (Addgene plasmid #104480 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding TDP-43-MBP-His6 for bacterial protein expression was a gift from Nicolas Fawzi (Addgene plasmid #104480; http://n2t.net/addgene:104480; RRID:Addgene_104480) (38) ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCh-hRab7A (#922) plasmid encoding mCherry-labeled version of human Rab7A protein was from Addgene (Cat# 61804). GFP-hRab5A.dn3 (#966) ...
-
bioRxiv - Cell Biology 2021Quote: The RFP-hRab5A.dn3 (#921) plasmid encoding RFP-labeled version of human Rab5A protein was from Addgene (Cat# 14437). The mCh-hRab7A (#922 ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757; http://n2t.net/addgene:70757; RRID:Addgene_70757) (69) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033; http://n2t.net/addgene:13033; RRID:Addgene_13033). Plasmid pcDNA3-YFP-APE1 (for WT YFP-APE1 protein ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ; http://n2t.net/addgene:167585 ; RRID:Addgene_167585).
-
bioRxiv - Cell Biology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486; http://n2t.net/addgene:72486;RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Neuroscience 2023Quote: ... were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008, Addgene) used as a backbone after excising axonGCaMP6s by BamHΙ and NheΙ ...
-
bioRxiv - Physiology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486; http://n2t.net/addgene:72486; RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Cell Biology 2024Quote: ... We next used the human EZH2 primary protein sequence available in the addgene for hEZH2 plasmid (#24230, Addgene) and predicted the possible cysteine residues using the GPS-SNO prediction tools ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The SNAP protein was amplified from the DNA-CARzeta-GFP plasmid (a gift from Ron Vale, Addgene # 89344). The monomeric streptavidin (mSA) ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein coding sequence of Lck-GFP was amplified from the Lck-GFP plasmid (Catalog no.61099, Addgene) using Phusion high fidelity polymerase (Catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... together with an expression vector for the VSV-G envelope protein (pCMV-VSV-G, Addgene plasmid no. 8454), an expression vector for GAG-Pol-Rev (psPAX2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP, subcloned into pCAG from Addgene #89446) plasmids to 3.5 µg/µL in molecular grade ddH2O with 5% sucrose and 0.1% Fast Green FCF ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmids for expression of lipid anchored fluorescent proteins were obtained from the Addgene repository: MyrPalm-CFP (Addgene #14867) and MyrPalm-GFP (#21037) ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Immunology 2022Quote: A lentivirus expressing the ASC-GFP fusion protein was prepared by transfection of pLEX-MCS-ASC-GFP (Addgene 73957), psPAX2 ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The negative transcriptional feedback circuit used for the experiment contained a transcriptional repressor protein TetR expressed under a self-repressible promoter (Addgene plasmid # 45774; http://n2t.net/addgene:45774; RRID:Addgene 45774). TetR was fused to the green fluorescent protein variant deGFP and measured using excitation and emission at wavelengths 485 nm and 525 nm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Microbiology 2021Quote: ... GFP-LMP2 and mStrawberry-Ub fusion proteins were constructed by transfecting hBMECs with pBABEpuro LC3-GFP vector (Addgene, 22405), pMRX-IRES-GFP-LMP2 (GFP-LMP2 was subcloned from pCND3-GFP-LMP2 ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... The constructs were provided with a packaging vector (Pax2, 12.5 µg) and the envelope protein VSV-G (3.3 µg, Addgene, #8454) in Opti-MEM medium to which the transfection reagent Polyethylenimine (1 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... that have reached ~80-90% confluency with the second generation pHR plasmid carrying the desired transgene (Supplementary Table S2) and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Immunology 2023Quote: CTLs were transiently transfected with the pEGFP plasmid encoding the EB1-GFP fusion protein (Addgene #17234, Watertown, Massachusetts, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: Fusion protein expression cassettes were cloned into the lentiviral expression vector LeGO-G2 (kind gift from Boris Fehse, Addgene plasmid #251917 ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... DNA encoding the indicated proteins were inserted between the attR recombination sites and shuttled into modified pLEX_307 vectors (Addgene) using Gateway technology (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus were packaged by co-transfection of the transfer plasmid encoding the protein of interest with psPAX2 (Addgene #12260) and pVSVG (Addgene # 35616 ...
-
bioRxiv - Bioengineering 2023Quote: ... by transfection with the lentiviral transfer vector plasmid (pWPI) that contains enhanced green fluorescent protein (eGFP) (Addgene plasmid # 12254), and provided by Dr ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Neuroscience 2023Quote: We transiently expressed the phototoxic KillerRed protein in Tg(SAIG213A:EGFP) fish by injecting a plasmid expressing KillerRed driven by UAS promoter (Addgene plasmid # 115516 ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... MDA-LM2 and HCC1806-LM2 cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.