Labshake search
Citations for Addgene :
651 - 689 of 689 citations for Recombinant Mouse NGF Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Physiology 2024Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Molecular Biology 2024Quote: ... A SRCAP gRNA designed using CRISPOR117 to target the C-terminal part of mouse SRCAP was added in pX330-gRNA vector (pX330-gRNA was a gift from Charles P. Lai (Addgene plasmid #158973)) by digestion with BbsI to build pX330_SRCAP ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... encoding the ELOVL7 protein (Uniprot ID: A1L3×0) was cloned into the baculovirus transfer vector pFB-CT10HF-LIC (available from The Addgene Nonprofit Plasmid Repository) for expression in Sf9 cells (Thermo-Fisher Scientific ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... vector expressing a constitutively active form of AMPKa (AMPKα21-312) and GFP (Green Fluorescent Protein) or a control AAV vector (Addgene: plasmid # 60127 and # 50465) were injected bilaterally in the BLA at P35 ...
-
bioRxiv - Bioengineering 2024Quote: ... pET28a-SUMO-SpyTag003 (N-terminal His6 tag-SUMO protein-SpyTag003) was cloned previously by Irsyad Khairil Anuar (University of Oxford) (GenBank and Addgene deposition in progress). pDEST14-SpyCatcher003-TEVs-SpyTag003DA (‘Masked SpyCatcher0003’ ...
-
bioRxiv - Immunology 2023Quote: Expi293F cells were cultured and transiently transfected with the pLenti-palmGRET reporter plasmid encoding the dual reporter palmitoylated EGFP-nanoluciferase protein (PalmGRET) (Addgene plasmid #158221 11) for EV production as described previously 23 ...
-
bioRxiv - Genetics 2024Quote: We use two constructs for epigenome editing: 1) dCAS9-DNMT3A/3L co-expressed with enhanced green fluorescent protein (eGFP) for selection 12 (Addgene, Catalogue number 128424), and 2 ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Cas9 protein was produced by the Weizmann Institute of Science Protein Purification Unit using the pET-28b-Cas9-His (Alex Schier Lab Plasmids, Addgene, Cambridge, MA, United States) as a template ...
-
bioRxiv - Neuroscience 2019Quote: ... Similar experiments were conducted using mammalian PSD-95 protein (prepared by transfecting expression vectors pCMV-PSD95-flag [FLAG-tagged; Addgene, #15463] into HEK293 cells) bound to GluN2B-peptide-containing Agarose resins ...
-
bioRxiv - Biophysics 2022Quote: ... the RNA-guided targeting of genes was achieved through coexpression of the Cas9 protein with gRNAs using reagents from the Church group48 (Addgene: http://www.addgene.org/crispr/church/). Targeting sequences of the gRNAs were as followed ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Cell Biology 2019Quote: Fluorescent protein sequences were obtained from lab stocks with the exception of mTagBFP2 which was amplified from mTagBFP2-pBAD (Addgene, Watertown, USA; plasmid ID 54572). The 3mTagBFP2 was a kind gift from Serge Pelet (University of Lausanne ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable expression of fluorescently tagged ciliary and centriolar proteins was achieved by modification of pCW-Cas9 using cDNAs encoding ARL13B (Addgene #40879, gift from Tamara Caspary), EHD1 (gift from Chris Westlake) ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were generated using three plasmids to ensure a single round of infectivity: a pseudotyping plasmid for transient expression of the VSV-G envelope protein (pMD2.G, Addgene plasmid #12259, gift from Didier Trono), a plasmid for transient expression of the viral gag/pol ...
-
bioRxiv - Molecular Biology 2023Quote: The MCS of pBAD24 (Guzman et al., 1995) was exchanged for the red fluorescent protein (RFP) cassette from pPGC-C (Addgene plasmid # 174580,(Bentham et al., 2021)) flanked by BsaI restriction sites ...
-
bioRxiv - Neuroscience 2024Quote: ... a 448 bp human synapsin-1 promoter element driving the neuronal specific expression of 4) the fluorescent protein mTagBFP2 (Addgene plasmid #191566 pLKO.1-TRC mTagBFP2) fused to the plasma membrane targeting sequence CAAX2 (Addgene plasmid #162247 ...
-
bioRxiv - Systems Biology 2021Quote: Inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-on inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Genetics 2023Quote: ... To generate vectors for the protein stability assay DNMT3B and mutant sequences were cloned into pLenti-DsRed-IRES-EGFP (Addgene plasmid 92194, a gift from Huda Zoghbi).