Labshake search
Citations for Addgene :
651 - 700 of 1261 citations for Recombinant Human Interleukin 7 Receptor His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Stable expression of fluorescently tagged ciliary and centriolar proteins was achieved by modification of pCW-Cas9 using cDNAs encoding ARL13B (Addgene #40879, gift from Tamara Caspary), EHD1 (gift from Chris Westlake) ...
-
bioRxiv - Genomics 2019Quote: ... coli expressing Streptococcus Pyogenes Cas9 carrying a C-terminal fusion to a hexa-histidine tag from the pET-28b-Cas9-His plasmid (Addgene http://www.addgene.org/47327) (56) ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC S285C and S329C variants for PRE, insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98665, 98667 respectively)
-
bioRxiv - Biophysics 2023Quote: ... and its variants were cloned into the pEG-BacMam expression vector with GFP and 8X-His tags at the N-terminus (Addgene, see Table S2). For FLAG-tagged KRAS expression constructs ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2021Quote: ... over V1 using an ultrafine dental drill and inserted a glass pipette backfilled with AAV2.1-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (titer: 7×1012 vg/mL, 20298-AAV1 Addgene). In total 50 nL was injected in V1 (bilateral binocular V1 for Task A and unilateral V1 for Task B ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml, viral prep #44361-AAVrg, Addgene, US,68). For canine adenovirus (CAV ...
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-GFP (titer ≥ 7×1012vg/mL, category number 37825, lot V9234) was purchased from Addgene (Watertown, MA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ...
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... experimental animals received bilateral infusions (0.5 µL/hemisphere) of AAV5-hSyn-DIO-hM3D(Gq)-mCherry (7×1012 vg/mL; Addgene) into the VTA as described in [32] ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Neuroscience 2021Quote: ... Mice were unilaterally injected with recombinant adeno-associated virus (rAVV) carrying the GCaMP6s transgene (pAAV.Syn.GCaMP6s.WPRE.SV40) purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Genetics 2020Quote: Cas9 recombinant protein was expressed in Escherichia coli BL21 (DE3) from plasmid pMJ915 (a gift from Jennifer Doudna; Addgene # 69090) and purified as previously described (34) ...
-
bioRxiv - Neuroscience 2020Quote: To express oChIEF-mCitrine in pOXR1-Cre mice, a recombinant adeno-associated virus (rAAV, serotype 1, 4.8×1013 VC/ml titer) expressing FLEXed oChIEF-mCitrine (Addgene #50973) was package by Vector Biolabs (Malvern ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant His6-mCerulean and His6- mTurquoise2 were prepared similarly using pBAD-mCerulean and pBAD-mTurquoise plasmids (Addgene, #54666 and #54844) and TOP10 competent cells (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... were injected in the right IC with the recombinant adeno-associated virus (rAAV) rAAV1/ Syn-Flex-Chronos-GFP (Lot # AV6551B, UNC Vector Core, Addgene # 62725 ...
-
bioRxiv - Cell Biology 2023Quote: After production of recombinant lentiviruses in HEK293T cells by co-transfection of the pLentiCRISPRv2 constructs with pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Molecular Biology 2021Quote: ... The human TLR4 overexpression plasmid was purchased from Addgene (Cat. #13086). The T695A and T656A mutations were generated in WT-YME1L1 plasmid via QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... human ubiquitin C-driven CymR Cuo repressor purchased from Addgene (#119907) into pPig-Hygro transposase backbone from Max Wilson ...
-
bioRxiv - Cell Biology 2022Quote: ... tdmIRFP from Max Wilson and human GSK3β purchased from Addgene (# 16260) ORFs were supplied to VectorBuilder for cloning and EF1α-driven expression into 3rd generation lentiviral backbone ...
-
bioRxiv - Cell Biology 2019Quote: ... The human coding sequence for MYH10 gene was derived from Addgene plasmid ID# 11348 (Wei & Adelstein ...
-
bioRxiv - Biochemistry 2021Quote: ... pLenti CMV/TO Zeocin DEST with either human XBP1s insert (Addgene), and pLenti CMV hygromycin DEST with a DHFR.ATF6(1-373 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmids encoding wild-type human RAB11 (#12679) was obtained from Addgene. The following primer sets were used for site directed mutagenesis:
-
bioRxiv - Cancer Biology 2020Quote: Human Tks5α was cloned into pCDH-CMV-MCS-EF1-Puro (Addgene) with a GFP sequence fused at the C-terminus ...
-
bioRxiv - Microbiology 2020Quote: Human CRISPR knockout pooled library (Brunello) was obtained from Addgene (#73178). Human CRISPRi pooled library (Dolcetto ...
-
bioRxiv - Cell Biology 2021Quote: ... The following plasmids were used: pEGFP-N1 human cofilin (Addgene 50859) and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Cell Biology 2020Quote: Human WT CXCR4 was acquired as a donor plasmid (#81957, Addgene) and recombined into a lentiviral destination vector (#25890 ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454 ...
-
bioRxiv - Genomics 2022Quote: Human STARR-seq-ORI vector was obtained from Addgene (plasmid #99296). 8ug of STARR-seq plasmid was digested with 20uL AgeI-HF® (R3552 ...
-
bioRxiv - Biochemistry 2022Quote: The human CRISPR knockout pooled library Brunello was obtained from Addgene (a gift from David Root and John Doench ...
-
bioRxiv - Cell Biology 2020Quote: 100 ng of human sgRNA library Brunello in lentiCRISPRv2 (Addgene, #73179) was transformed into electrocompetent Endura cells (#60242 ...
-
bioRxiv - Immunology 2019Quote: ... Human codon optimized cas9 DNA was obtained from (Addgene, Plasmid #41815). To generate the knockout cell lines ...
-
bioRxiv - Neuroscience 2020Quote: Human pcDNA3.1-CHRNA7-mGFP was a gift from Henry Lester (Addgene plasmid # 62629 ...
-
bioRxiv - Microbiology 2021Quote: ... The lentiviral vector expressing human ACE2 (Dr. Sonja Best, Addgene 154981) was used with the lentiviral packaging plasmid psPAX2 (Dr ...
-
bioRxiv - Immunology 2020Quote: GeCKO and Brunello whole-genome human libraries were acquired from Addgene. Smaller scale validation library was created by selecting the top 300 positive and 50 negative regulators from the Brunello screen and filtering for expression in Ramos cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... and/or the mammalian expression vectors for human HNF4A2 (#31100, Addgene), LXRα (110) ...
-
bioRxiv - Microbiology 2023Quote: ... and Human Interferon-Stimulated Gene CRISPR Knockout pooled Library (#125753, Addgene) (OhAinle et al. ...
-
bioRxiv - Neuroscience 2023Quote: Human Htt-exon1-Q94 fragment from pTreTight-Htt94Q-CFP (Addgene, #23966) was cloned into pBlueScript SK+ (kind gift of Eva Brinkman ...
-
bioRxiv - Biochemistry 2022Quote: Monomeric EGFP was subcloned into vectors containing human AR (Addgene #29235) and AR-V7 (Addgene #86856 ...
-
bioRxiv - Microbiology 2023Quote: Human TREX1 sequences were derived from plasmid GFP-TREX1 (Addgene 27219) and TREX1-D18N (Addgene 27220).
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA encoding human cGAS (NM_138441.3) was purchased from Addgene (#108674) and subcloned into pEGFP-C3 vector.