Labshake search
Citations for Addgene :
651 - 700 of 1806 citations for OF 1 CAS 919973 83 4 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Viral injections of 1 μl hSyn.iGluSnFr.WPRE.SV40 (Addgene, plasmid #98929-AAV1) for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862 ...
-
bioRxiv - Neuroscience 2024Quote: ... viral injections of AAV2/1-CAMK1a-gCaMP6f (Addgene #100834-AAV1) were made into the binocular zone ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... DJ-1 (a gift from Mark Cookson, Addgene plasmid 29347), synapto-iATPSnFR2-miRFP670nano3 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x 1013). For GCaMP expression in the DRG neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-Syn-GCaMP6m-RPL10a (1−1013 gc/mL; Addgene #158777) was injected into PM ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(1)-T2A-GAL4DBD-Hsp70 (Addgene #62903), pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904) ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(1)-T2A-VP16AD-Hsp70 (Addgene #62908), and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV.1.hSyn.dio.EGFP (anterograde labelling, 140 nl, Addgene, no. 50457); AAV.9.hSy.chI.loxP.EGFP.loxP.SV40p(A ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV1.hSyn.GCaMP6s.WPRE.SV40 (Addgene, titre > 1×10^13 v.g./mL). Injections of 100 nL were performed at a rate of 23 nL/sec at 3 different depths from skull surface ...
-
bioRxiv - Cancer Biology 2024Quote: ... GST-Runx3 using pGEX4T-1-RUNX3 aa 49-187 (Addgene) or both His- and GST-tagged Runx3 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1 ug CRISPR/CAS9 guideRNA (pXAT2 plasmid, Addgene: #80494). After nucleofection ...
-
bioRxiv - Neuroscience 2024Quote: ... As a control we used pLKO.1-Scrambled (Addgene #136035). The sequences of the shRNAs are the following:
-
bioRxiv - Cell Biology 2024Quote: ... Final constructs generated were pLKO.1-scrambled-GFP (RRID: Addgene_228736) and pLKO.1-shDrp1-GFP (RRID ...
-
bioRxiv - Bioengineering 2024Quote: ... [1] pMDLg/pRRE was a gift from Didier Trono (Addgene plasmid 12251 ...
-
bioRxiv - Cell Biology 2024Quote: ... the frame selector pCas9-mCherry-Frame +1 (Addgene plasmid #66940), and the universal donor pCRISPaint-mNeon (Addgene #174092 ...
-
bioRxiv - Cancer Biology 2024Quote: ... H2B-iRFP670-p2a-mCerulean-Geminin (a.a.1–110) (Addgene, 223959), and DHB (a.a.995–1087)-mVenus-p2a-mCherry-Rb (a.a.886–928 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following ORF24 fragments: residues 1-201 (ORF24-NTD) (Addgene #138420), residues 1-271 (Addgene #138421) ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478 ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into the pLKO.1 vector (Addgene, 8453 or 26655). Overexpression vectors of either lentiviral (N106 or N174 ...
-
bioRxiv - Systems Biology 2022Quote: pSIRV-AP-1-mCherry was a gift from Peter Steinberger (Addgene plasmid # 118095 ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cell Biology 2020Quote: Individual sgRNAs (Supplemental Table 1) were cloned into pLentiCRISPRv2 (Addgene #52961) at the BsmBI site as described by the depositor ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Neuroscience 2021Quote: were generated using pLKO.1 vector following instructions provided by Addgene. The shRNA sequence was selected using BLOCK-iT™ RNAi Designer provided by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... SH2 domain sequences were obtained from Addgene (pGEX-SHP-1(NC)-SH2 ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the OMS using TOMM20 (residues 1-55, from Addgene 66753).
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Cell Biology 2023Quote: SH-SY5Y cells stably overexpressing LAMP-1-Flag-RFP (Addgene; #102931) and stained with CellMask Green (1/1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424) ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were cloned into pLentiCRISPR v2 Lko.1-puro (Addgene #52961) linearized with BsmBI ...