Labshake search
Citations for Addgene :
651 - 700 of 1191 citations for Mouse Liver Expressed Antimicrobial Peptide 2 LEAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... the kit (Golden Gate TALEN and TAL Effector Kit 2.0) consisting of 86 library vectors was ordered from Addgene (www.addgene.org). To assemble the dTALe harboring 16 repeats ...
-
bioRxiv - Plant Biology 2020Quote: ... The following binary plasmids were assembled by Golden Gate cloning using the MoClo Tool Kit for plants (Addgene kit #1000000044) (Weber et al. ...
-
bioRxiv - Bioengineering 2022Quote: Cas9 and FE expression vectors were constructed using the pX330A and pX330S vectors contained in Multiplex CRISPR/Cas9 Assembly System Kit (Kit #1000000055, Addgene)48 with some modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... The TRUPATH kit was purchased from Addgene (#1000000163) and was a gift from Bryan Roth ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a gift from John Dueber (Addgene kit # 1000000061). The constructs encoding sequential incorporation of serine in place of tyrosine in the FUS IDR was based on previously published sequences66 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The mouse Sik3 cDNA purchased from GE Dharmacon (Clone ID: 6515742) was cloned into a LentiV_Neo vector (Addgene_108101) using In-Fusion cloning system (Clontech) ...
-
bioRxiv - Immunology 2021Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244; http://n2t.net/addgene:15244; RRID:Addgene_15244). Human α3-nAChR-GFP was obtained from Sino Biological (HG29719-ACG) ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Immunology 2020Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... a gRNA targeting exon three of mouse TOM1L2 (GCTCTAAAGAAGCGGCTTAG) was cloned into pX459V2.0-eSpCas9(1.1) (gift from Yuichiro Miyaoka; Addgene; plasmid no ...
-
bioRxiv - Neuroscience 2022Quote: ... the Adamts2 or TGFβR2 coding sequence was amplified by PCR using mouse Adamts2 and TGFβR2 ORF plasmids (pCMV-Adamts2, Harvard plasmid clones; pCMV-TGFβR2, Addgene) as templates ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genetic depletion of mouse RhoA or AKT1 in vivo was conducted using pSECC (#60820; Addgene, Watertown, MA, USA), a lentiviral-based system that combined both the CRISPR system and Cre recombinase ...
-
bioRxiv - Cancer Biology 2023Quote: ... male mice were injected with 6.4 X 108 GC/mouse of AAV8.TBG.PI.Cre.rBG (AAV-TBG-Cre, Addgene, 107787-AAV8) diluted in 100μL PBS via the tail vein ...
-
bioRxiv - Biochemistry 2023Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663; http://n2t.net/addgene:13663 ; RRID:Addgene_13663). The mouse Src gene was subcloned into the pEGN Bacmam vector(41) ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid kit used for the generation of TALENs was a gift of Daniel Voytas and Adam Bogdanove (Addgene kit #1000000016). Plasmid encoding assembled TALENs was linearized with SacI ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP tagged OsHIPP19 and OsHIPP20 were generated by Golden Gate methods (Engler et al. 2008) using MoClo Plant Parts Kit and MoClo Plant Tool Kit (Addgene, UK). OsHIPP19 and OsHIPP20 were cloned into pICH47732 with a GFP tag at the N-terminus ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2023Quote: ... were constructed in according to Golden Gate TALEN assembly protocol and using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene, Kit #1000000024). CIscript-GoldyTALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: ... Plasmid construction was performed by modular cloning using the MoClo Tool Kit and the MoClo Plant Parts Kit (Addgene, 28–30). A detailed MoClo protocol and the list of vectors used can be found in 18.
-
bioRxiv - Biochemistry 2024Quote: Plasmids encoding GPCRs were obtained from various sources (as indicated Key Resources Table) or subcloned into pcDNA3.1 from the PRESTO-Tango GPCR kit (Addgene Kit #1000000068) as described next ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...