Labshake search
Citations for Addgene :
651 - 700 of 1428 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse ULK1 cDNA was isolated from a p3xFLAG-CMV14-mULK1 vector (#24301, Addgene) by PCR and cloned into the Halo-tagged pFN21A vector (Promega ...
-
bioRxiv - Microbiology 2023Quote: The Mouse Genome-wide Knockout CRISPR sgRNA Library was purchased from Addgene (#67988)5 ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Genetics 2023Quote: ... Codon-optimized of full-length mouse RNF212B was cloned into pET-28b (+) (Addgene) with a C-terminal 6xHis tag ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525; http://n2t.net/addgene:45525; RRID:Addgene_45525), pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526; http://n2t.net/addgene:45526; RRID:Addgene_45526), and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Cancer Biology 2021Quote: ... For expression of the Cas9 protein the lentiCas9-Blast expression vector was used (Addgene plasmid #59262 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat sequences (PguCas13b ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat sequences (PguCas13b ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR amplified from PmCDA1-1x uracil-DNA glycosylase inhibitor protein (UGI) (Addgene #79620), evoCDA1 pBT277 (Addgene #122608) ...
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Biophysics 2020Quote: The plasmid for membrane scaffold protein was MSP1D1 in pET28a was purchased from Addgene and prepared as previously described (Hagn et al. ...
-
bioRxiv - Immunology 2020Quote: ... and VSV-G protein-encoding plasmid pMD2.G were obtained from Addgene (Watertown, MA).
-
bioRxiv - Developmental Biology 2019Quote: ... RNPs of Cas9 protein (Cas9-mCherry, pMJ293 (Burger et al., 2016) (available from Addgene)) and sgRNA were in vitro-assembled for 10 min at 37°C in 300 mM KCl to ensure maximum cleavage efficiency and microinjected into the cell of one-cell stage embryos (Burger et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... The Spike protein from pcDNA3.1-SARS2-Spike was a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Microbiology 2021Quote: ... A VSV G protein expression plasmid was obtained from Addgene (Watertown, MA; Cat.# 8454).
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...