Labshake search
Citations for Addgene :
651 - 700 of 1316 citations for Mouse Anti Human Papilloma virus L1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207 ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX6P1-human full-length LIC1 plasmid was a gift from Ron Vale (Addgene plasmid # 74597 ...
-
bioRxiv - Biophysics 2022Quote: The gene with codon-optimized human dysferlin cDNA was obtained from Addgene (Plasmid 67878) [47] ...
-
bioRxiv - Neuroscience 2019Quote: ... and VSV-G envelope generated by inserting human Sirt3 plasmid (Purchased from Addgene #13814) into HIV.SIN.cPPT.CMV.eGFP.WPRE (Purchased from U Penn Vector Core ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B-Raf under T7 promoter was a gift from Dustin Maly (Addgene #40775) and was further modified by the insertion of two additional FLAG tags and of an RBS sequence ...
-
bioRxiv - Physiology 2020Quote: ... Human FL-Dhh sequence was obtained after EcoRI digestion of pBS hSHH (Addgene ID13996) and then cloned at the EcoRI site of pCDNA3.1 myc His to generate the pcDNA3-FL-Shh plasmid ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Neuroscience 2021Quote: ... The human codon-optimized Cas9 (kindly made available by George Church, Addgene plasmid # 41815) and the sgRNA (encoded by a pFUS-U6 vector ...
-
bioRxiv - Biochemistry 2021Quote: The gene encoding human SLC7A11(I.M.A.G.E. clone IRAUp969G0966D) was cloned into pLexM (Addgene 99844) 53 with an N-terminal Flag tag inserted via PCR ...
-
bioRxiv - Cell Biology 2021Quote: Human SEC24D was cloned from pJK15 plasmid into pAcGFP1-C1 (Addgene, Watertown, MA, USA) to generate a GFP-SEC24D fusion gene ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNA to human raptor (plasmid#1857) and rictor (plasmid#1853) were purchased from Addgene. The preparation of shRNA infected HEK293 cells have been described previously (28).
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Immunology 2022Quote: ... An amino-terminal 3xFlag epitope tagged human GLUT3 was generated by PCR (Addgene #72877) (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: Class-switched VRC07 constructs were generated from human isotype backbone plasmids obtained from Addgene. The different human heavy chain constant regions were PCR amplified from the Addgene plasmids and inserted into the previously described AAV transfer vector 11 encoding the VRC07 heavy chain variable region and VRC07 kappa light chain ...
-
bioRxiv - Molecular Biology 2022Quote: The GeCKOv2 human CRISPR knockout pooled library (a gift from Feng Zhang, Addgene #1000000048) was used as described (19 ...
-
bioRxiv - Immunology 2023Quote: ... The amplicons were cloned into human IGHG1 or IGKC or IGLC expression vectors (Addgene number 80795 ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-expressing DND-41 cells were transduced with Human GeCKOv2 library (Addgene 1000000048, 1000000049) at MOI~0.3 and selected with 1μg/ml of puromycin for 6 days ...
-
bioRxiv - Immunology 2023Quote: ... The CRISPR library vectors (Human CRISPR Metabolic Gene Knockout Library; Addgene, Pooled Library #110066) 12 or the single sgRNA vectors ...
-
bioRxiv - Neuroscience 2023Quote: ... human TDP-43M337V has subcloned into the pLenti CMV Puro DEST (W118-1, Addgene) plasmid as previously described (Zhang et al ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids containing human BRCA1 cDNA were a gift from Junjie Chen (Addgene, Plasmid #99394). We cloned the BRCT and RING variant library by designing primers (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: The human ASH2L sequence was introduced to the lentiviral vector pLEX305-NdTAG (Addgene#91797) using a Gateway LR reaction (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Cell Biology 2023Quote: The genome-wide human SAM sgRNA library (kind gift from Feng Zhang, Addgene #1000000057) was amplified as previously described (Joung et al. ...
-
bioRxiv - Physiology 2024Quote: HEK 293T were transfected with a human TLR3 plasmid or an empty vector (Addgene). Briefly ...
-
bioRxiv - Genetics 2023Quote: Plasmid mutagenesis was performed on pKS070 - pCAGGS-3XFLAG-(human) CTCF-eGFP (Addgene Plasmid #156448) for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248 ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: The Human Brunello library was a gift from David Root and John Doench18 (Addgene #73178). The Toronto human knockout pooled library (TKO ...
-
bioRxiv - Developmental Biology 2021Quote: ... confluent human embryonic kidney (HEK293T) cells were co-transfected with pWPXL (Addgene, Cambridge, MA, USA), and a mixture of packaging helper plasmids (psPAX ...
-
bioRxiv - Developmental Biology 2020Quote: The histone acetyltransferase domain from human p300 was subcloned from a published construct (Addgene, 61357) (Hilton et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... Wild-type human CDH1 on a pcDNA3 plasmid was obtained (hE-cadherin-pcDNA3, Addgene, 45769). Variants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2019Quote: ... which were made by amplifying human Rab1a or Rab5c (Rab1a: Addgene: #46776, Rab5c: GeneArt synthesis) by PCR and inserting the genes in pEGFP-C1 via SacI-KpnI ...
-
bioRxiv - Neuroscience 2019Quote: ... the human TSC1 gene was PCR amplified from a vector containing the hTSC1 cDNA (Addgene) 70 ...
-
bioRxiv - Immunology 2021Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Bioengineering 2020Quote: ... Full-length human ACE2 was a kind gift from Hyeryun Choe 22 (Addgene plasmid #1786).
-
bioRxiv - Immunology 2021Quote: The full human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048, a gift from Feng Zhang) was used for genome-wide screening40 ...
-
bioRxiv - Cell Biology 2021Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector or eGFP-HSP70 (Addgene, Cat#15215) plasmid using an Amaxa human dermal fibroblast kit and manufacturer recommended U2OS protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCU gRNA3 (hMCU gRNA1) was subcloned into the lentiCRISPR v2 backbone (Addgene, Plasmid #52961) and transfected into wild-type HEK293 cells via nucleofection as previously described ...
-
bioRxiv - Cancer Biology 2021Quote: GeCKO v2 human library made by Zhangfeng’s lab was purchased from Addgene (Watertown, MA, USA) amplified as described(Joung et al. ...
-
bioRxiv - Microbiology 2021Quote: Human furin was cloned in the sleeping beauty transposon plasmid26 pSB-bi-RP (Addgene #60513), transfected along with transposase ...
-
Sequence and structural variations determining the recruitment of WNK kinases to the KLHL3 E3 ligasebioRxiv - Molecular Biology 2020Quote: ... human KLHL3 (a.a. 298–587) was cloned into the pNIC28-Bsa4 vector (Addgene plasmid #110251), which provides an N-terminal hexahistidine tag as previously described [9] ...