Labshake search
Citations for Addgene :
651 - 700 of 920 citations for Mouse Anti Hepatitis B Virus Core Antibody M412 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... was designed to target the regions close to the start codon (Figure 1A,B) and the sgRNA sequence was inserted into the pX459 V2.0 plasmid (#62988, Addgene). The reference plasmids containing PA tag sequence were constructed in pBluescript II SK (+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL1R1 sgRNA was custom designed against IL1R1 promoter G-quadruplex (G4-motif B) and cloned in pX333 (Addgene 64073) backbone after replacing Cas9 with mCherry.
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Molecular Biology 2021Quote: 144 million Lig4-/- abl pre-B cells were transduced with a viral tet-inducible guide RNA library (Pooled Library #67988, Addgene) containing 90,000 gRNAs targeting over 18,000 mouse genes ...
-
bioRxiv - Bioengineering 2021Quote: ... the U6.3-gRNATraB fragment was PCR amplified from the sgRNATra-B plasmid using primers 2XgRNA-5F and 2XgRNA-6R and was cloned into the sgRNAβTub plasmid (Addgene #112691). To build the TI-pgSITsxl,βTub,Hsp-Cas9 and TI-pgSITTraB,βTub,Hsp-Cas9 constructs (Supplementary Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Microbiology 2021Quote: The plasmids coding GeCKO sub-libraries A and B were amplified and prepared according to the provided guidelines (Lentiviral Crispr Toolbox, Addgene). 60 million T98G/Cas9 cells were transduced with GeCKO LVs at a MOI of 0,1 to cover about 100-times the half-library complexity ...
-
bioRxiv - Cell Biology 2021Quote: ... and non-targeted Suv420-GFP was achieved by cloning the respective cDNA into Addgene vector CENP-B DBD INCENP GFP (45237, Addgene) at NheI / BamH1 ...
-
bioRxiv - Biochemistry 2021Quote: Site-directed mutagenesis was performed on KRAS 1-169 (Q61H, isoform b, a gift from Cheryl Arrowsmith, Addgene plasmid #25153) to obtain the wild-type sequence ...
-
bioRxiv - Biochemistry 2023Quote: E.coli codon optimized gBlocks encoding CAHS D and its mutant proteins used in this study were synthesized by (Integrated DNA Technologies) and cloned into pET-28 b (+) vector (Addgene) for bacterial expression ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Molecular Biology 2019Quote: ... ΔPPXY)-T2A-GFP were generated by PCR from pCDNA4/TO-HA-NLS-SV40-B-MYB (this work) and pSpCas9n(BB)-2A-GFP (PX461) (Addgene #48140). All entry vectors were subcloned into pENTR3C (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and Lig4-/- abl pre-B cells and MCF10A human mammary epithelial cells used in this study all contain pCW-Cas9 (Addgene# 50661), which has a FLAG-tagged Cas9 cDNA under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Cancer Biology 2023Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2020) were deleted of their hygromycin B resistance gene via Lipofectamine transfection of a plasmid expressing FlpE (Addgene #20733; (Beard et al. 2006)) ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...