Labshake search
Citations for Addgene :
651 - 700 of 918 citations for JAM A Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049; http://n2t.net/addgene:24049; RRID:Addgene_24049). This construct (hIR ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then transduced with the Calabrese Human CRISPR Activation Pooled Library (Set A, Addgene, 92379-LV) using enough cells to obtain a library coverage of 500 cells per sgRNA at an MOI of 0.4.17 Selection with puromycin (0.6 μg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and cloned into a bicistronic expression vector (pX330) containing human codon-optimized Cas9 and RNA components (Addgene, #42230). The guide sequences targeting the AMPKα1 gene (PRKAA1 ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Genomics 2020Quote: ... Cas9 expressing human melanoma cell line 2686 was transduced with lentiviral particles produced as described above using expression plasmid pXPR_011 (Addgene #59702 ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR Brunello genome-wide knockout library was a gift from David Root and John Doench (Addgene #73178). MelJuSo cells stably expressing FLAG-VGLL3 were generated and two batches of 100 million cells were infected at an MOI of 0.3 ...
-
bioRxiv - Biochemistry 2019Quote: ... a mammalian expression vector pRK5 encoding EGFP tagged wild-type (WT) human tau (pRK5-EGFP-tau, # 46904, RRID: Addgene_46904), which contains four C-terminal repeat regions and lacks the N-terminal sequences (0N4R) ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used the sequence of a human codon optimized Streptococcus pyogenes Cas9 (SpCas9) obtained from pX330-U6-Chimeric_BB-CBh-SpCas9 from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG5 knockout P3 and T98G GBM cell lines were generated by using LentiCRISPRv268 (purchased from Addgene, plasmid# 99573). Plasmids were transfected into 293T cells using BBS/CaCl2 to produce lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: ... full-length human SETDB1 cDNA was cloned into the NotI sites of the pcDNA3.1(+)-IRES-GFP (Addgene; Cat#: 51406). For transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cells used for RNA sequencing were first integrated with Not1-linearized pBABE-neo-hTERT plasmid (Addgene plasmid # 1774) and selected with G418 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341; http://n2t.net/addgene:78341; RRID: Addgene_78341) and mScarlet (Bindels et al. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... human umbilical vein endothelial cells (HUVECs) were infected with lentivirus constructs for CRISPR/Cas9 (Addgene plasmid #52961, lentiCRISPR v2) induced knock-out for Rbpj35 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Microbiology 2021Quote: ... The wildtype human HIF1α gene was obtained from pcDNA3-HIF1α plasmid (Addgene 18949, a gift from William Kaelin (45)) ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Immunology 2019Quote: ... The sgRNA oligos were annealed and ligated into the human codon-optimized SpCas9 expression plasmid (pX330; Addgene plasmid # 42230), as described previously63 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a non-human control were amplified from the pSB700 plasmid and cloned into PB-TRE-dCas9_VPR (Addgene #63800) using the following primers ...
-
bioRxiv - Cell Biology 2019Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048)35 and pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230)97 were gifts from Feng Zhang ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-hRab5B.dn3 (#1008) plasmid encoding GFP-labeled wild-type version of human Rab5B isoform was from Addgene (Cat# 61802). GFP-hRab5B(S34N ...
-
bioRxiv - Immunology 2020Quote: Individual sgRNAs from human v2 library78 were cloned into lentiviral vectors expressing either a Puromycin resistance cassette (60955, Addgene) or into a modified vector expressing a Blasticidin resistance cassette (Gift from Nevan Krogan ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding amino acids Ala696-Phe740 of human DDX1 was cloned into UC Berkeley MacroLab 438C (Addgene plasmid #55220). The resulting plasmid encoded for untagged RTCB(1-505) ...
-
bioRxiv - Microbiology 2020Quote: ... the human ACE2 gene (Miaolingbio #P5271) was PCR-amplified and cloned into the pLV-EF1a-IRES-blast (Addgene #85133). The human TMPRSS2 and DPP4 gene (Sino Biological #HG13070-CM ...
-
bioRxiv - Biochemistry 2022Quote: The expression plasmid for full-length human TRIM21 (HLTV-hTRIM21, referred to as TRIM21FL) was ordered from Addgene (#104973). Recombinant TRIM21FL was expressed and purified as described previously (Clift et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The human ACE2 coding sequence was amplified and inserted into the vector plasmid pLV-EF1α-IRES-Puro (#85132, Addgene) for transient expression in HEK293T cells to obtain virus containing the target gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The human Brunello CRISPR knockout pooled sgRNA library was a gift from David Root and John Doench (Addgene #73178). sgRNA library lentivirus was produced via large-scale transfection of 20 × 150mm dishes of HEK293T/17 (12 × 106 cells/dish were plated and transfected with 30 µg plasmid DNA the following day) ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/10 encoding ChrimsonR(K176R) and the red fluorophore tdTomato under control of the human synapsin promoter (1.13 × 1013 gc/ml; AddGene plasmid #59171 ...
-
bioRxiv - Neuroscience 2022Quote: ... and the cyan fluorophore mCerulean under control of the human synapsin promoter (1.5 × 1012 gc/ml; customized from AddGene plasmid #59171 ...
-
bioRxiv - Cell Biology 2023Quote: Human genome targeting CRISPR Knock-Out (GeCKO) v2 lentiviral pooled libraries (A and B libraries) were purchased from Addgene and amplified according to a published protocol (Sanjana et al. ...
-
bioRxiv - Microbiology 2023Quote: ... A no-template preparation (negative control) and a plasmid encoding egfp (positive control, pClneoEGFP human RASSF6b, Addgene plasmid #37021), along with non-transduced EBECs and HBECs were included ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentiviral constructs for HMGA2 overexpression were obtained by sub cloning human HMGA2 from pMXS-hs-HMGA2 (Addgene, no. 52727) into pCDH-EF1a-eFFly-mCherry replacing eFFly using restriction enzymes XbaI and BamHI-HF ...
-
bioRxiv - Biochemistry 2023Quote: Human Brunello genome-wide CRISPR KO pooled library (gift from David Root and John Doench, Addgene catalog no. 73178) was amplified by electroporation into Stbl4 electrocompetent cells (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The reporter plasmids were subcloned using the vector backbone of pGL410_INS421 which has a human insulin promotor regulating firefly luciferase expression (a gift from Kevin Ferreri Addgene plasmid #49057 ...
-
bioRxiv - Neuroscience 2023Quote: Wild type Drosophila and human spectrins were cloned into a histidine tagged vector (2BC-T cloning vector, Addgene # 31070) using ligation independent cloning to obtain C-terminally tagged proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids encoding the human UBF gene tagged with EGFP and nucleolin gene tagged with EGFP were obtained from Addgene (plasmids # 26672 and #28176 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into a pcDNA3.1-Hygro(-)-like with a C-terminal HRV 3C cut site and human Fc tag amplified from Addgene plasmid 145164 using standard cloning techniques ...
-
bioRxiv - Cell Biology 2023Quote: pEGFP-N1 human cofilin WT / S3A / S3E were a kind gift from James Bamburg (Addgene plasmid # 50859 / # 50860 / # 50861). Cofilin-1 ...
-
bioRxiv - Genetics 2023Quote: The rTetR(SE-G72P)-HDAC4-T2A-mTurquoise plasmid was generated by PCR amplifying full length human HDAC4 with appended gibson homology arms from pLB37_PB_pGK-H2B-mIFP-T2A-rTetR-HDAC4-zeo (Addgene #179440) using Q5 hot start polymerase (NEB M0494S) ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726; http://n2t.net/addgene:59726; RRID: Addgene_59726) and targeted the first exon of the TBXT gene ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Immunology 2024Quote: The human Calabrese CRISPR activation pooled library was a gift from David Root and John Doench (Addgene 92379, 92380). To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Developmental Biology 2024Quote: ... The TFAP2A gRNA targeted site of human TFAP2A construct (gift of Robert Tjian, Addgene #12100, (Williams and Tjian, 1991)) was mutated using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: cDNAs encoding human TSSK6 were obtained in pDONR223 (DNASU) and cloned into pLX302 or pLX304 (Addgene Plasmid #25896, #25890) using the Gateway Cloning system (Thermo Fisher Scientific) ...