Labshake search
Citations for Addgene :
651 - 700 of 3055 citations for 8 Chloro 1 2 3 4 tetrahydro 1 4 methylphenyl sulfonyl 5H 1 benzazepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid pLKO.1 GFP shRNA (Addgene, #30323, RRID:Addgene_30323) was a gift from David Sabatini (110).The targeting sequences are described in Supplemental Table S1 ...
-
bioRxiv - Systems Biology 2024Quote: ... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... shp53 pLKO.1 puro was purchased from Addgene (19119) (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-EGFP (Addgene, Catalog# 50457-AAV 1), pAAV5-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-EGFP (Addgene, Catalog# 50457-AAV 1); pAAV5-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... we utilized the pAAV2/1 packaging plasmid (Addgene #112862), diverging from our previous use of the pAAV 2/8 or 2/9 plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA (5’ - TTACTGCTCATCCTTGTCCT-3’) was cloned into pCFD5 vector (Port et al., 2014) (Addgene #73914) and then the resulting vector was injected into attP2 site (BDSC #25710) ...
-
bioRxiv - Pathology 2019Quote: ... gRNA_ex93.0: 5’-GCGTGAGGACAACCGCGTGCAGG-3’) were cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene 48138) and introduced into CRL1502 iPSCs by reverse transfection using TransIT-LT1 (Mirus Bio) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rev 5’-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3’ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting ...
-
bioRxiv - Cell Biology 2023Quote: ... the gRNA sequence 5’-AATGAGGCCTTGGAACTCA-3 was cloned into the Px330 vector (Addgene plasmid #42230) and transfected into cells using Lipofectamine Stem according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... SgRNA targeting EGFR (5’-CGATCTCCACATCCTGCCGG-3’) was cloned into the lentiGuide-puro vector (Addgene, USA) (18) ...
-
bioRxiv - Immunology 2023Quote: ... and a non-targeting control (5’-CACCGGTATAATACACCGCGCTAC-3’) were cloned into the lentiCRISPRv2 vector (Addgene). The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5′-GGCTGCCGTAGCGCGACGTG-3′) were cloned into pLentiCRISPRv2 (Addgene-52961). An NT gRNA (5′-GTATTACTGATATTGGTGGG-3′ ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were stereotaxically injected under isoflurane anesthesia (1% v/v in oxygen, 1 L/min) with 250 nL of AAV8-hSyn-DIO-hM3d(Gq)-mCherry (Addgene, Catalog # 44361-AAV8) at a rate of 50 nL/min using a 1000 nL Hamilton syringe bilaterally in the dorsal striatum (coordinates ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2VP16 was generated by fusing the open reading frame for the herpes simplex virus-1 (HSV-1) VP16 (amplified from pActPL-VP16AD plasmid, Addgene plasmid #15305, Watertown, USA) activation domain to Err2 ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Puro DEST (w118-1) and pLenti CMV Blast DEST (706-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17398, #17452, #17451). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene plasmids #12259 ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Synthetic Biology 2019Quote: Were-1 DNA was cloned into the pBV-Luc (Addgene) vector in order to obtain a fused riboswitch-firefly luciferase (Fluc ...
-
bioRxiv - Cancer Biology 2019Quote: ... a lentiviral vector pLKO.1 (Addgene, 8453, Cambridge, MA, USA) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-DIO-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pLKO.1-Tet-Neo obtained from Addgene. For inducible shRNA constructs ...
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-puro (Addgene #52628, a gift from Scot Wolfe) and the modified pLKO.1-puro/GFP vector system described in (Phelan et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47802 (Addgene, catalog number: 48007). Level 1 pICH47811-pTCSn::nls:tGFP::tATPase (position 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47811 (Addgene, catalog number: 48008). To amplify IPT3 promoter (gene ID v4 ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1-puro-shNT (gift from Jacob Corn, Addgene #109012) was used as a scrambled shRNA control ...
-
bioRxiv - Cell Biology 2021Quote: ... and AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399)
-
bioRxiv - Neuroscience 2021Quote: ... Animals were injected with saline-diluted AAV2/1.hSyn.GCaMP6f.WPRE.SV40 (Addgene) at a depth of 250 and 550 µm (final concentration ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by pLenti-CMV-Puro DEST vector (Addgene, w118-1). The plasmids were propagated in DH5α bacterial cells (Life Technologies) ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2019Quote: ... and β-arrestin 1-FLAG (#14687) were obtained from Addgene.
-
bioRxiv - Cancer Biology 2019Quote: ... expressed from a pLKO.1-hygro plasmid backbone (Addgene #24150). Three days after lentiviral transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 constructs were co-transfected with psPAX2 (Addgene 12260) and VsvG (Addgene 8454 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb_EfrCD#1 was cloned into expression plasmid pBXNPHM3 (Addgene #110099) using FX cloning and expressed as described previously [42] ...