Labshake search
Citations for Addgene :
651 - 700 of 2063 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... pCMV-p38-CA-EGFP and pCMV-eGFP-N1 (Addgene, 6085-1) by using standard Lipofectamine 3000 protocols (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... from Thermo Fisher at a 1:1.5 Lipo:DNA ratio for GFP-Cortactin (Addgene 50728), mEmerald-Talin (Addgene 54266 ...
-
bioRxiv - Cell Biology 2020Quote: Individual sgRNAs (Supplemental Table 1) were cloned into pLentiCRISPRv2 (Addgene #52961) at the BsmBI site as described by the depositor ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Neuroscience 2021Quote: were generated using pLKO.1 vector following instructions provided by Addgene. The shRNA sequence was selected using BLOCK-iT™ RNAi Designer provided by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... SH2 domain sequences were obtained from Addgene (pGEX-SHP-1(NC)-SH2 ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Biochemistry 2022Quote: DNA constructs for the expression of KRAS4B (1-169) (Addgene #159539) and RAF1 (52-131 ...
-
bioRxiv - Neuroscience 2022Quote: ... for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene, plasmid #100834-AAV1) for calcium imaging were administered directly into the hippocampus ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the OMS using TOMM20 (residues 1-55, from Addgene 66753).
-
bioRxiv - Molecular Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424) ...
-
bioRxiv - Physiology 2023Quote: ... pLKO.1-Puro-scramble shRNA (1864) plasmids were obtained from Addgene. The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354 ...
-
bioRxiv - Cell Biology 2023Quote: SH-SY5Y cells stably overexpressing LAMP-1-Flag-RFP (Addgene; #102931) and stained with CellMask Green (1/1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2retro-syn-jGCaMP7f-WPRE (Addgene 104488, 1 × 1013 GC/ml) [1:1 mixture] ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Neuroscience 2022Quote: ... and 100-200 nl cre-dependent tdTomato (AAV2/1.FLEX.tdTomato.WPRE.SV40, Addgene), and some cases ...
-
bioRxiv - Cell Biology 2023Quote: ... The Level 1 plasmids pL1P1OsActinP:hpt-int:35sT selection cassette (Addgene #165423), pL1P2OsUbiP:Cas9:NosT (Addgene #165424 ...
-
bioRxiv - Neuroscience 2023Quote: ... These genomes were packaged in serotype 1 AAV capsids by Addgene (catalog numbers 52473-AAV1 ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/Foff-ChRmine-oScarlet (Addgene 137161, 1×1013 titer) was bilaterally injected into either LH (AP ...
-
bioRxiv - Biophysics 2023Quote: ... the pLKO.1 puro (Addgene; 8453; a gift from Bob Weinberg) backbone was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the pLKO.1 lentiviral vector system (Addgene, Cambridge, MA, USA). A list of the stable cell lines generated is summarized in supplementary table S1.
-
bioRxiv - Neuroscience 2023Quote: ... and one of the following helper plasmids: pAAV2/1 (Addgene #112862), pAAV2/2 (Addgene #104963) ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x x 1013). For sparse expression of GCaMP in the brainstem neurons ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3_SARS2_omicron BA.1 (Addgene plasmid #180375; http://n2t.net/addgene: 180375; RRID:Addgene_180375) and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 CaMK2a-EYFP (1.0 × 1013 gp/mL) (Addgene #105622)
-
bioRxiv - Neuroscience 2023Quote: ... we used pKLO.1 containing a non-targeting sequence (Addgene #1864) (Sarbassov et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-GFP (Addgene 51502-AAVrg, titer > 1 × 1013 pfu/ml) was used as control.
-
bioRxiv - Microbiology 2024Quote: ... pAR18 was constructed in three steps: 1) pTargetF (obtained from Addgene) was linearized with the primer pair AR430/431 while the cas9 sgRNA sequence was replaced by the sacB gene including its native promoter (amplified with AR432/433 from pEP17-KM [44]) ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNAs were cloned into pLentiCRISPR v2 Lko.1-puro (Addgene #52961) linearized with BsmBI ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shGFP control was obtained from Addgene (cat#30323). Wildtype IDH1 with overexpression plasmid 3X HA tag was generated by Twist Bioscience (pTwist Lenti SFFV Puro) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subcloned into the lentiviral vector pLKO.1-puro (Addgene, USA). All plasmids used in this study were verified by DNA sequencing ...
-
bioRxiv - Biophysics 2024Quote: ... with 1 [µg] of F-tractin GFP plasmid (Plasmid #58473 Addgene) and the P5 Primary Cell 4D-NucleofectorTM X Kit to then electroporate corresponding to the transfection program (CA-167 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of AAV9.hsyn.FLEX.iGluSnFR.WPRE.SV40 (a gift from Loren Looger, Addgene plasmid # 98931 ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Cancer Biology 2019Quote: ... HCT116-Dnmt1Δ3-5 cells were transfected with pcDNA3 vector containing WT full length DNMT1 (36939, AddGene) and empty pcDNA3 vector as a transfection control (10792 ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...