Labshake search
Citations for Addgene :
651 - 700 of 3087 citations for 7 Oxabicyclo 4.1.0 hept 3 ene 2 5 dione 3 hydroxymethyl 4 1E 1 penten 1 yl 1S 6R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid mEGFP- lifeact-7 (Addgene # 54610) was a gift from Michael Davidson and Lamp1-mGFP (Addgene # 34831 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid #54560) were gifted by Michael Davidson ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 and 8 were ordered from Addgene. The plasmids ordered were HDAC2 Flag (Addgene plasmid # 36829 ...
-
bioRxiv - Cell Biology 2021Quote: ... and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Microbiology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid#54560) were gifted by Michael Davidson ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μg of pMD2.G (Addgene # 12259), and 11 μg of pMDLg/pRRE (Addgene # 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR and products were cloned into NheI and EcoRV restriction sites (Table 3: marked with blue) of pcDNA3.1-hygro vector (Addgene, kindly provided by Mark Richards-Bayliss group ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2014 to clone the annealed oligos into pCFD3-dU6:3-gRNA plasmid (Addgene, plasmid# 49410, Port et al., 2014). Transformants were verified via Sanger sequencing (Genewiz ...
-
bioRxiv - Developmental Biology 2019Quote: ... Guides targeting col-ECRM and col-LCRM were inserted in the pCFD4: U6:3-gRNA vector (Addgene no: 49411) as described [58] ...
-
bioRxiv - Genomics 2021Quote: ... we performed 80 co-transfections of HeK293T virus packaging cells (at approximatelly 60-70% confluence on 10 cm dishes) with 3 μg of the pDECKO_mCherry plasmid library and 2.25 μg of the packaging plasmid pVsVg (Addgene 8484) and 750 ng of psPAX2 (Addgene 12260 ...
-
bioRxiv - Immunology 2022Quote: ... and mSGK3 exon 3 (TTCAAGACATTAAATGCAG) were designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and cloned into TLCV2 (Addgene plasmid # 87360,) as described previously5455 ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was injected into worms along with a plasmid containing transposase (pCFJ601, Peft-3::Mos1 transposase, Addgene #34874) and co-injection markers (pGH8 Addgene #19359 ...
-
bioRxiv - Genetics 2023Quote: ... and a 3’ UTR harboring the WPRE element was cloned in the pT7-PEmax for IVT plasmid (Addgene 178113)2 ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.7 μg pLenti6.3-HA-NL-tetraspanin plasmids or pLenti6.3-CD63-pHluorin plasmid were co-transfected with 0.9 μg pREV (Addgene, 12253) and 1.8 μg pRRE (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
Cytonemes coordinate asymmetric signaling and organization in the Drosophila muscle progenitor nichebioRxiv - Developmental Biology 2022Quote: ... The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR (Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB vector (Addgene). 5’HA-T2A-nls:Gal4:VP16-STOP-3’HA was assembled in correct 5’-to-3’ order between Not1 and EcoR1 sites of the pJet1.2 vector.
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Molecular Biology 2019Quote: ... sgRNAs that target the 3′ end of the respective coding sequences were cloned into hSpCas9 plasmid (PX458, Addgene Plasmid #48138) (Ran et al ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Microbiology 2022Quote: C-terminal endogenous tagging of loci was performed in TgPRUΔKu80ΔHXGPRT by targeting the 3’UTR of ROCY1 with a specific gRNA cloned into the pUniversal-CAS9 plasmid (Addgene #52694) and then co-transfected with a homology repair cassette amplified from the pLIC-HXGPRT plasmid (as outlined in (Fox et al. ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... eft-3::hpo-9 or BTBD9 alone were co-injected into tm3719 strain with pG2M36 (myo-3::dsRed) and pBCN27-R4R3 (rpl-28::PuroR, Addgene), which were used as the selective markers for transformation ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Neuroscience 2019Quote: ... The intracellular solution also contained 50 µM of the red fluorescent dye AlexaFluo 594 and 3 plasmids with the following concentrations42: 100µg/µL pCAG-dsRed2 (Addgene #15777), 200 µg/µL pCMV-oG48 (Addgene 74288 ...