Labshake search
Citations for Addgene :
651 - 700 of 1265 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μl of AAV2/5-GfaABC1D-Lck-GCaMP6f (1013 genome copies/ml) (Addgene viral prep # 52924-AAV5) was injected into the DLS ...
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Molecular Biology 2019Quote: ... mNT-sgRNA-R: 5’-AAACCGCGGAGCCGAATACCTCGC-3’) were cloned into the lenti-sgRNA(MS2)-zeomycin backbone (Addgene #61427) using BsmBI ...
-
bioRxiv - Neuroscience 2019Quote: Mice 5-7 weeks old received bilateral microinfusion of AAV1-CamKiia-hChR2(H134R)-mCherry.WPRE.hGH (Addgene, #26975-AAV1) layer 2/3 of the barrel cortex (−1.3mmAP ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transduced with floxed jGCaMP7b (AAV1-syn-FLEX-jGCaMP7b-WPRE; Addgene #104493, MOI = 5×105 vg) [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9; https://www.addgene.org/100833/RRID:Addgene_100833) was injected unilaterally into the DS (L = ±1.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860; http://n2t.net/addgene:55860; RRID:Addgene_55860). Matrix-roGFP (mt-roGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the first 639 bp of the 5’ end of p65HSF1 from pAC1393-pmax-NLSPUFa_p65HSF1 (Addgene, #71897). These were then Gibson assembled along with an IDT gBlock containing the last 300 bp of p65HSF1 that had been codon optimised for expression level detection distinct from endogenous mRNA ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Genetics 2023Quote: ... the FKBP coding sequence was amplified from the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:Addgene_20297) or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5.CaMKII.tdTomato (Neurophotonics, 661-aav5) was used to label excitatory neurons and AAV9.CaMKII.GCaMP6s.WPRE.SV40 (Addgene, 107790) was employed to image excitatory neuronal calcium activity ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138) containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... we used an existing CMV-driven SARS-CoV-2 plasmid (pcDNA3.1-SARS2-Spike, Addgene 145032)(Shang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Cell Biology 2019Quote: ... the guide RNA sequence (Supplemental Item 2) was cloned into the PX330 plasmid (Addgene #42230), which expresses S ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...