Labshake search
Citations for Addgene :
651 - 700 of 2400 citations for 2 4 Dichloro 1 2 iodophenoxy benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: Prime Editor 2 (PE2) plasmid coding for the SpCas9 gene fused with the MLV reverse transcriptase was obtained from Addgene Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... PINK1 and PARKIN (Supplemental Table 2) were designed using CRISPOR.org14 and inserted into LentiCRISPRv2 plasmid15,16 (a gift from Feng Zhang (Addgene plasmid # 52961), as done before7 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Expi293F cells were transfected with pcDNA3-SARS-CoV-2-S-RBD-sfGFP (a gift from Erik Procko, Addgene plasmid # 141184) using ExpiFectamine™ 293 Transfection Kit according to manufacturer’s directions (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Biophysics 2022Quote: ... RRID:Addgene_141370)85or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2022Quote: ... We have also generated targeting fragments to insert arrays into MosTI sites that use hygromycin and Pmlc-2::gfp but have not tested these fragments (although we deposited the reagents with Addgene). The protocols are identical except for using targeting fragments and sgRNAs that are specific to each insertion site (listed in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: Chemical-genetic screens were initiated by thawing 2 × 1ml aliquots (1.0 OD600 units/mL) of the Mtb CRISPRi library (RLC12; Addgene 163954) and inoculating each aliquot into 19ml 7H9 supplemented with kanamycin (10 μg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... A plasmid encoding stabilized SARS-CoV-2 spike protein S-HexaPro (Hsieh et al., 2020) was a gift from Jason McLellan (Addgene plasmid #154754 ...
-
bioRxiv - Biochemistry 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was previously described (Hsieh et al. 2020) and was a gift from Jason McLellan (Addgene plasmid #154754 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro (a kind gift from Neven Krogan, available from Addgene #141391) with PEI ...
-
bioRxiv - Molecular Biology 2020Quote: ... lentivirus was produced in HEK293FT cells transfected with NOCT Δ(2-15)-3F pCW57.1 and the pRSV-Rev (Addgene #12253), pMD2.G (Addgene #12259) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pHCKan-yibDp-CBD-hGLY was constructed by DNA assembly with 2 PCR products amplified from (i) a plasmid coding hGLY under a T7 promoter (pHCKan-T7-CBD-hGLY, Addgene #134940 ...
-
bioRxiv - Genetics 2020Quote: ... the reporter construct was made by cloning the sequence for Renilla luciferase and SARS-CoV-2 frameshift signal in the 0 frame upstream of the firefly luciferase sequence in the pISO plasmid (Addgene), with firefly luciferase in the −1 frame ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by replacing the mCitrine in pA2721 with eGFP and correcting the frame shift mutation (missing a G at codon#2) in the natMx6 coding sequence in the original plasmid acquired from Addgene. The TurboID tagging plasmid (pA2859 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Genomics 2021Quote: An sgRNA targeting PSAP exon 2 (sgRNA sequence: GGACTGAAAGAATGCACCA) was cloned into plasmid px330-mcherry (px330-mcherry was a gift from Jinsong Li (Addgene plasmid # 98750 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Genomics 2022Quote: The PCR product was cloned into the pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 vector (Addgene #6125554) using HindIII and XbaI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... that target exon 2 of TREM2 nearby the location of R47H (G>A) and a genomic TTAA were purchased from Addgene. A donor plasmid was made comprising homology arm 1 (HA1 ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids encoding spikes of SARS-CoV-2 variants Delta (Cat. No. 172320) and Omicron (Cat. No. 179907) were procured from Addgene, USA.
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 virus-like particles were prepared as previously described (68) by co-transfecting plasmids for N (Addgene 177937); M and E (Addgene 177938) ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Physiology 2023Quote: ... sgRNA primers were (Table 2) cloned into BbsI-HF linearized pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene, Plasmid Cat. #64324) or pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... the resistance cassette flanked by LoxP sites (Sec16) was excised by transfection of 2 µg of pBS598 EF1alpha-EGFPcre plasmid (plasmid #11923; Addgene) that encodes for cre recombinase.
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Supplementary Table 2) into the BbsI restriction sites of the pX459 vector (#62988, Addgene). An empty pX459 vector was used to generate matching control cell lines ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer: 2 × 1012 virus molecules/ml) and placed a second microinjection of 200 nl of AAV8-hSyn-DIO-mCherry (Addgene, Catalog#50459-AAV8 ...
-
bioRxiv - Neuroscience 2024Quote: ... or 2 μg of a dominant-negative PAK1 plasmid (pCMV6M-PAK1 H83L H86L K299R, Addgene plasmid # 26592 by Jonathan Chernoff). This transfection was maintained for two days ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-hSyn-GCaMP6f-P2A-nls-dTomato virus (titer 2 × 1013 GC/mL) that co-expresses GCaMP and nucleus-localized static tdTomato signals was purchased from Addgene, which was a gift from Jonathan Ting (Addgene viral prep #51085-AAV1 ...
-
bioRxiv - Molecular Biology 2024Quote: We transfected HAP1 cells with 2 µg of pX330 U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230; (Cong et al, 2013)) containing LAD-specific or AVVS1-specific guide RNAs ...
-
bioRxiv - Cancer Biology 2024Quote: ... with the plasmid of interest (POI) and two plasmids encoding packaging proteins for viral vector (pAX.2 Addgene Plasmid #35002), pMD2.G Addgene Plasmid #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... targeting two regions of ATP5I’s cDNA (sgATP51 #1 and sgATP5I #2) and one RNA guide targeting GFP (sgGFP) sequence were subcloned into BsmBI restriction site of lentiCRISPRv2 plasmid (#52961, Addgene). For re-expression of ATP5I in control (sgGFP ...