Labshake search
Citations for Addgene :
601 - 650 of 870 citations for Recombinant Mouse Erbb2 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... or pCAG-DeAct-SpvB (a fusion protein of DeAct-SpvB with EGFP, subcloned into pCAG from Addgene #89446) plasmids to 3.5 µg/µL in molecular grade ddH2O with 5% sucrose and 0.1% Fast Green FCF ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmids for expression of lipid anchored fluorescent proteins were obtained from the Addgene repository: MyrPalm-CFP (Addgene #14867) and MyrPalm-GFP (#21037) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The mouse Sik3 cDNA purchased from GE Dharmacon (Clone ID: 6515742) was cloned into a LentiV_Neo vector (Addgene_108101) using In-Fusion cloning system (Clontech) ...
-
bioRxiv - Immunology 2021Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244; http://n2t.net/addgene:15244; RRID:Addgene_15244). Human α3-nAChR-GFP was obtained from Sino Biological (HG29719-ACG) ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Immunology 2020Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... a gRNA targeting exon three of mouse TOM1L2 (GCTCTAAAGAAGCGGCTTAG) was cloned into pX459V2.0-eSpCas9(1.1) (gift from Yuichiro Miyaoka; Addgene; plasmid no ...
-
bioRxiv - Neuroscience 2022Quote: ... the Adamts2 or TGFβR2 coding sequence was amplified by PCR using mouse Adamts2 and TGFβR2 ORF plasmids (pCMV-Adamts2, Harvard plasmid clones; pCMV-TGFβR2, Addgene) as templates ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genetic depletion of mouse RhoA or AKT1 in vivo was conducted using pSECC (#60820; Addgene, Watertown, MA, USA), a lentiviral-based system that combined both the CRISPR system and Cre recombinase ...
-
bioRxiv - Cancer Biology 2023Quote: ... male mice were injected with 6.4 X 108 GC/mouse of AAV8.TBG.PI.Cre.rBG (AAV-TBG-Cre, Addgene, 107787-AAV8) diluted in 100μL PBS via the tail vein ...
-
bioRxiv - Biochemistry 2023Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663; http://n2t.net/addgene:13663 ; RRID:Addgene_13663). The mouse Src gene was subcloned into the pEGN Bacmam vector(41) ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...
-
bioRxiv - Immunology 2022Quote: A lentivirus expressing the ASC-GFP fusion protein was prepared by transfection of pLEX-MCS-ASC-GFP (Addgene 73957), psPAX2 ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The negative transcriptional feedback circuit used for the experiment contained a transcriptional repressor protein TetR expressed under a self-repressible promoter (Addgene plasmid # 45774; http://n2t.net/addgene:45774; RRID:Addgene 45774). TetR was fused to the green fluorescent protein variant deGFP and measured using excitation and emission at wavelengths 485 nm and 525 nm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Microbiology 2021Quote: ... GFP-LMP2 and mStrawberry-Ub fusion proteins were constructed by transfecting hBMECs with pBABEpuro LC3-GFP vector (Addgene, 22405), pMRX-IRES-GFP-LMP2 (GFP-LMP2 was subcloned from pCND3-GFP-LMP2 ...
-
bioRxiv - Neuroscience 2022Quote: ... The constructs were provided with a packaging vector (Pax2, 12.5 µg) and the envelope protein VSV-G (3.3 µg, Addgene, #8454) in Opti-MEM medium to which the transfection reagent Polyethylenimine (1 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... that have reached ~80-90% confluency with the second generation pHR plasmid carrying the desired transgene (Supplementary Table S2) and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Immunology 2023Quote: CTLs were transiently transfected with the pEGFP plasmid encoding the EB1-GFP fusion protein (Addgene #17234, Watertown, Massachusetts, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: Fusion protein expression cassettes were cloned into the lentiviral expression vector LeGO-G2 (kind gift from Boris Fehse, Addgene plasmid #251917 ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... DNA encoding the indicated proteins were inserted between the attR recombination sites and shuttled into modified pLEX_307 vectors (Addgene) using Gateway technology (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus were packaged by co-transfection of the transfer plasmid encoding the protein of interest with psPAX2 (Addgene #12260) and pVSVG (Addgene # 35616 ...
-
bioRxiv - Bioengineering 2023Quote: ... by transfection with the lentiviral transfer vector plasmid (pWPI) that contains enhanced green fluorescent protein (eGFP) (Addgene plasmid # 12254), and provided by Dr ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Neuroscience 2023Quote: We transiently expressed the phototoxic KillerRed protein in Tg(SAIG213A:EGFP) fish by injecting a plasmid expressing KillerRed driven by UAS promoter (Addgene plasmid # 115516 ...
-
bioRxiv - Molecular Biology 2020Quote: ... this line (148.4) was derived from E14 mouse ES cells and is homozygous for a Tir1-2A-Puro cassette (Addgene plasmid # 92142 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus injections per mouse pup were in a total volume of 4μL of AAV9-syn-GCaMP6s (Addgene, MA, USA) with a titer of 1Χ1013 vg/mL ...
-
bioRxiv - Microbiology 2020Quote: The mouse cDNA sequence of filamin A from MEF cells was amplified and cloned into pcDNA3-myc plasmid (Addgene). The resulting plasmid pcDNA3- myc-FLNA was transiently transfected in the MEF cells and then the transfected cells were infected with Toxoplasma for 18 h (MOI ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Immunology 2020Quote: The targeting constructs used for introducing the in-frame mAID sequences into mouse endogenous CTCF locus (pEN84, Addgene #86230) and for introducing the OsTir1-V5 expression cassette into endogenous Rosa26 locus (pEN114 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse Sp7 and GFP lentiviruses were generated by transfecting HEK293T cells with a blasticidin resistance backbone (Addgene, plasmid 26655) along with psPAX2 and MD2.G ...
-
bioRxiv - Developmental Biology 2020Quote: The plasmid encoding for the mouse Dbx2 RNA probe was a gift from Thomas Jessell (Addgene plasmid 16288; 33). Instead ...