Labshake search
Citations for Addgene :
601 - 626 of 626 citations for Recombinant Mouse Cpa1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... sgRNAs were selected from either the Brunello (human) or Brie (mouse) libraries and cloned into either lentiCRISPR v2 or lentiCRISPR v2-Blast (Addgene #83480). Lentivirus was produced and used to infect indicated cell lines ...
-
bioRxiv - Developmental Biology 2024Quote: ... of Fbxo24 and Skp1 were cloned and amplified using cDNA obtained from mouse testis and inserted into the multiple cloning site of pCAG1.1 vector (Addgene; Plasmid #173685). To generate the expression vector coding Fbxo24(ΔF-box) ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides were cloned into either the pX602-AAV-Cre sgRNA backbone for CRISPR/Cas9-induced acute gene knockout in mouse liver or the pLentiCRISPR V2 (Addgene, 52961) & pLentiGuide Blast for genome editing in cell lines ...
-
bioRxiv - Genomics 2020Quote: The CRISPR/Cas9 plasmid (CTCF-mouse-3sgRNA-CRISPRexp-AID) was assembled using the Multiplex CRISPR/Cas9 Assembly System kit57 (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Physiology 2024Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Molecular Biology 2024Quote: ... A SRCAP gRNA designed using CRISPOR117 to target the C-terminal part of mouse SRCAP was added in pX330-gRNA vector (pX330-gRNA was a gift from Charles P. Lai (Addgene plasmid #158973)) by digestion with BbsI to build pX330_SRCAP ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Systems Biology 2021Quote: Inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-on inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...