Labshake search
Citations for Addgene :
601 - 641 of 641 citations for Mouse Anti Rift Valley Fever Virus Nucleoprotein Antibody GG3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... CRISPR sense and anti-sense guides were cloned into pX335 (Addgene plasmid 42335 ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry GST-tagged nanobodies (Addgene #70696, (Katoh et al, 2016)) were expressed and purified according to published protocol (Katoh et al. ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (BL21DE3) expressing GST tagged anti-GFP nanobody (Addgene plasmid #61838) (Katoh et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... purified His14-Avi-SUMOEu1-anti GFP nanobody (expressed from pTP396, Addgene #149336)74 was biotinylated using BirA (expressed from pTP264 ...
-
bioRxiv - Cell Biology 2021Quote: ... The scFv gblocks were ligated with linearized anti-HA frankenbody-mEGFP (Addgene # 129590) by EcoRI through Gibson assembly (anti-FLAG FB-mEGFP) ...
-
bioRxiv - Cell Biology 2022Quote: ... encoding anti-GFP HALO nanobody (a gift from Lennart Wirthmueller, Addgene plasmid #111090) were expressed in bacteria and respectively GST- and His-purified in-house ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid expressing anti-CRISPR protein (pEJS581; pCSDest2-AcrIIC4Hpa-FLAG-NLS; Addgene # 113436) was included in the triple-transfection packaging process to maintain intact rAAV:HDR:cleaved plasmids during production ...
-
bioRxiv - Systems Biology 2021Quote: Inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-on inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Molecular Biology 2020Quote: The expression of His14-Avi-SUMOEu1-anti GFP nanobody from plasmid pTP396 (Addgene # 149336) was carried out exactly as described in detail before (Pleiner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The expression of His14-Avi-SUMOEu1-anti GFP nanobody from plasmid pTP396 (Addgene #149336) was carried out with the following modification ...
-
bioRxiv - Bioengineering 2020Quote: ... Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned separately into the pHLsec mammalian expression vector (Addgene, #99845) via Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... the antibody component of the SunTag system (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS45, a gift from Ron Vale, Addgene #60904) was digested with EcoRI+NotI and subcloned into the blunted BamHi site of pCW-TRE ...
-
bioRxiv - Bioengineering 2023Quote: ... To generate the monoclonal IgG1 antibody CSL362 biosimilar MIRG123 the VH and VKL sequences were cloned into AbVec2.0-IGHG1 (Addgene plasmid # 80795) and AbVec1.1-IGKC (Addgene plasmid # 80796) ...
-
bioRxiv - Molecular Biology 2021Quote: The bacterial expression vector for anti-GFP nanobody pGEX-6P-1 was procured from Addgene. E ...
-
bioRxiv - Cell Biology 2021Quote: ... the GST-tagged anti-GFP nanobody construct in pGEX-6P-1 vector (Addgene ID # 61838) was transformed to BL21 RIL (DE3 ...
-
bioRxiv - Biophysics 2023Quote: Anti-EGFP nanobody plasmid (pOPINE GFP) was a gift from Brett Collins (Addgene plasmid #49172)43 and transformed into BL21 cells for purification ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Cell Biology 2022Quote: ... The prokaryote expression vector encoding an anti-GFP mCherry nanobody (a gift from Martin Spiess, Addgene plasmid #109421) and pOPINE GFP nanobody:HALO:His6 ...
-
bioRxiv - Synthetic Biology 2023Quote: A lentiviral transfer plasmid encoding encoding an anti-CD19 synNotch receptor driven by pPGK was acquired from Addgene (pHR_PGK_antiCD19_synNotch_Gal4VP64 was a gift from Wendell Lim ...
-
bioRxiv - Molecular Biology 2021Quote: The Mir20b and anti-Mir20b were cloned into the pOTTC385-pAAV CMV-IE IRES EGFP vector (Addgene plasmid # 102936)(Nelson et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2020Quote: The anti-GCN4-scFv was generated from pHR-scFv-GCN4-sfGFP-GB1-dWPRE (Addgene plasmid 60907 (Tanenbaum et al., 2014), cut with EcoRI/XbaI and inserted into pcDNA3 ...
-
bioRxiv - Bioengineering 2024Quote: ... pET28a-SnoopTag-AffiHER2-SpyTag (N-terminal His6–SnoopTag–anti-HER2 Affibody–SpyTag) (GenBank accession no. KU296975) (Addgene deposition in progress) (Brune et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... DNA encoding the SNAP or mSA2 coding region was codon-optimized and synthesized (Integrated DNA Technologies) and cloned in place of the anti-CD19scFv in plasmid pHR-PGK-antiCD19-synNotch-Gal4VP64 (Addgene# 79125) using isothermal assembly ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Cell Biology 2023Quote: MDCK cells expressing GFP-Rab19 on the Rab19 KO background were lysed and incubated with GST-tagged anti-GFP nanobody (recombinantly produced from pGEX6P1-GFP-Nanobody, Addgene Plasmid #61838) or with free GST for negative control ...