Labshake search
Citations for Addgene :
601 - 639 of 639 citations for Mouse Anti Hepatitis A Virus VP3 Antibody 1881 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... CRISPR sense and anti-sense guides were cloned into pX335 (Addgene plasmid 42335 ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry GST-tagged nanobodies (Addgene #70696, (Katoh et al, 2016)) were expressed and purified according to published protocol (Katoh et al. ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (BL21DE3) expressing GST tagged anti-GFP nanobody (Addgene plasmid #61838) (Katoh et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... purified His14-Avi-SUMOEu1-anti GFP nanobody (expressed from pTP396, Addgene #149336)74 was biotinylated using BirA (expressed from pTP264 ...
-
bioRxiv - Cell Biology 2021Quote: ... The scFv gblocks were ligated with linearized anti-HA frankenbody-mEGFP (Addgene # 129590) by EcoRI through Gibson assembly (anti-FLAG FB-mEGFP) ...
-
bioRxiv - Cell Biology 2022Quote: ... encoding anti-GFP HALO nanobody (a gift from Lennart Wirthmueller, Addgene plasmid #111090) were expressed in bacteria and respectively GST- and His-purified in-house ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid expressing anti-CRISPR protein (pEJS581; pCSDest2-AcrIIC4Hpa-FLAG-NLS; Addgene # 113436) was included in the triple-transfection packaging process to maintain intact rAAV:HDR:cleaved plasmids during production ...
-
bioRxiv - Systems Biology 2021Quote: Inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-on inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Molecular Biology 2020Quote: The expression of His14-Avi-SUMOEu1-anti GFP nanobody from plasmid pTP396 (Addgene # 149336) was carried out exactly as described in detail before (Pleiner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The expression of His14-Avi-SUMOEu1-anti GFP nanobody from plasmid pTP396 (Addgene #149336) was carried out with the following modification ...
-
bioRxiv - Bioengineering 2020Quote: ... Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned separately into the pHLsec mammalian expression vector (Addgene, #99845) via Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... the antibody component of the SunTag system (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS45, a gift from Ron Vale, Addgene #60904) was digested with EcoRI+NotI and subcloned into the blunted BamHi site of pCW-TRE ...
-
bioRxiv - Bioengineering 2023Quote: ... To generate the monoclonal IgG1 antibody CSL362 biosimilar MIRG123 the VH and VKL sequences were cloned into AbVec2.0-IGHG1 (Addgene plasmid # 80795) and AbVec1.1-IGKC (Addgene plasmid # 80796) ...
-
bioRxiv - Molecular Biology 2021Quote: The bacterial expression vector for anti-GFP nanobody pGEX-6P-1 was procured from Addgene. E ...
-
bioRxiv - Cell Biology 2021Quote: ... the GST-tagged anti-GFP nanobody construct in pGEX-6P-1 vector (Addgene ID # 61838) was transformed to BL21 RIL (DE3 ...
-
bioRxiv - Biophysics 2023Quote: Anti-EGFP nanobody plasmid (pOPINE GFP) was a gift from Brett Collins (Addgene plasmid #49172)43 and transformed into BL21 cells for purification ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Cell Biology 2022Quote: ... The prokaryote expression vector encoding an anti-GFP mCherry nanobody (a gift from Martin Spiess, Addgene plasmid #109421) and pOPINE GFP nanobody:HALO:His6 ...
-
bioRxiv - Synthetic Biology 2023Quote: A lentiviral transfer plasmid encoding encoding an anti-CD19 synNotch receptor driven by pPGK was acquired from Addgene (pHR_PGK_antiCD19_synNotch_Gal4VP64 was a gift from Wendell Lim ...
-
bioRxiv - Molecular Biology 2021Quote: The Mir20b and anti-Mir20b were cloned into the pOTTC385-pAAV CMV-IE IRES EGFP vector (Addgene plasmid # 102936)(Nelson et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2020Quote: The anti-GCN4-scFv was generated from pHR-scFv-GCN4-sfGFP-GB1-dWPRE (Addgene plasmid 60907 (Tanenbaum et al., 2014), cut with EcoRI/XbaI and inserted into pcDNA3 ...
-
bioRxiv - Bioengineering 2024Quote: ... pET28a-SnoopTag-AffiHER2-SpyTag (N-terminal His6–SnoopTag–anti-HER2 Affibody–SpyTag) (GenBank accession no. KU296975) (Addgene deposition in progress) (Brune et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... DNA encoding the SNAP or mSA2 coding region was codon-optimized and synthesized (Integrated DNA Technologies) and cloned in place of the anti-CD19scFv in plasmid pHR-PGK-antiCD19-synNotch-Gal4VP64 (Addgene# 79125) using isothermal assembly ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Cell Biology 2023Quote: MDCK cells expressing GFP-Rab19 on the Rab19 KO background were lysed and incubated with GST-tagged anti-GFP nanobody (recombinantly produced from pGEX6P1-GFP-Nanobody, Addgene Plasmid #61838) or with free GST for negative control ...