Labshake search
Citations for Addgene :
601 - 650 of 722 citations for LD78 beta CCL3L1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Full-length human KRAS4B G12C was ectopically expressed from the retroviral expression vector pBABE containing an N-terminal HA-tag (Addgene #58901). Viral particles were generated by transient transfection of each expression vector into HEK 293T cells using Fugene6 (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were then infected with an inducible Tet-ON lentivirus carrying the human PLK1 cDNA (pLenti CMVtight Hygro DEST from Addgene #26433) and selected with hygromycin (350 µg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... carrying the human CRISPR KO pooled library Brunello in a lentiGuide-Puro backbone (gift from David Root and John Doench; Addgene #73178) to a final volume of 2 mL with 4 µg/mL polybrene ...
-
bioRxiv - Immunology 2020Quote: ... Human orfeome clone 10217) was gateway cloned into an attR-destination vector encoding an N-terminal FLAG tag (Addgene, Plasmid #18700), with the Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Microbiology 2021Quote: ... The oligos of CRISPRa library were synthesized in Synbio Technologies according to the Human Genome-wide CRISPRa-v2 Libraries (Addgene, 83978) (30).
-
bioRxiv - Neuroscience 2020Quote: ... TH-Cre hPSC cells (passage were transduced with a lentiviral construct under control of the human TH-Cre promoter (Addgene, plasmid # …..). The cells were transduced at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used the Gateway recombination system to introduce the following Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into pHAGE-TRE-DEST-NBioTAP (Addgene #53568) and pHAGE-TRE-DEST-CBioTAP lentiviral vectors (Addgene #53569) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human N-WASP GBD domain was PCR amplified from pCS2-mRFP-GBD (a kind gift from William Bement, Addgene plasmid 26733) with XhoI/AscI flanking restriction sites and cloned into pET-pmKate2 to generate mKate-GBD ...
-
bioRxiv - Biophysics 2020Quote: The plasmid coding for human EGFR tagged with EGFP (hEGFR-EGFP) was a kind gift from Alexander Sorkin (Addgene plasmid #32751) (27) ...
-
bioRxiv - Immunology 2020Quote: ... Human G3BP1 cDNAs with or without stop codon were amplified by PCR from pN1/G3BP1-iRFP (Okada lab plasmids, Addgene #129339) with the sense primer 5′ -GCCAGATCTATGGTGATGGAGAAGCCTAG-3′ and the antisense primers 5′ -GCCGAATTCGGATCCTTACTGCCGTGGCGC-3′ or 5′ -GCCGAATTCGGATCCCTGCCGTGGCGCAAG-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... CFP-hRab5C(S35N).dn3 (#1006) encoding Cerulean-labeled dominant negative mutant version of human Rab5C isoform was from Addgene (Cat# 11504). GFP-hEEA1 (#970 ...
-
bioRxiv - Neuroscience 2020Quote: ... the insert consisting of GtACR2-ts-mCerulean3-βHK-Chrimson was cloned into an AAV2-backbone behind a human synapsin (hSyn) promoter (pAAV-hSyn-BiPOLES-mCerulean; Addgene #154944). A soma-targeted ...
-
bioRxiv - Genetics 2021Quote: ... were placed downstream of the human U6 promoter in the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro backbone (Addgene, #71236). The guide RNA sequences were:
-
bioRxiv - Molecular Biology 2020Quote: ... and RPL22-3xHA (primers JG106/109; human cDNA template) with EcoRI/PstI digested pLV-TetO-hNGN2-P2A-eGFP-T2A-Puro (Addgene #79823) backbone ...
-
bioRxiv - Immunology 2021Quote: ... A549ACE2 cells were generated using lentiviral transduction of a human ACE2 cDNA expressing plasmid (backbone: pLV-EF1a-IRES-Puro (Addgene 85132) as previously described [31] ...
-
bioRxiv - Cell Biology 2021Quote: ... a codon-optimized signal sequence from human ER-resident p23 was inserted into the AgeI site of p-sfGFP-N1 (Addgene #54737). p23ss-sfGFP lacking the stop codon was PCR amplified and flanked with a 3’ NheI site and TA cloned into pCRII-TOPO vector ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and Lig4-/- abl pre-B cells and MCF10A human mammary epithelial cells used in this study all contain pCW-Cas9 (Addgene# 50661), which has a FLAG-tagged Cas9 cDNA under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Neuroscience 2021Quote: Full-length human APLP1 gene with a Flag tag in the N-terminal was cloned from pCAX APLP1 (Addgene plasmid#30141) and the primers were shown in Key Resources Table (NheI-Flg-hAPLP1-F/XhoI-His-hAPLP1-R) ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by amplifying TPD54 by PCR from human Tumor protein D54 (IMAGE clone: 3446037) and inserting into pIRES-EGFP-puro (Addgene #45567) via NheI and XhoI ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Cell Biology 2022Quote: ... The pHUJI-LC3B construct was cloned by inserting a codon-optimized gblock encoding pHUJI fused to the N-terminus of human LC3B into the NotI site of pENTR4 (Addgene #17424), and then Gateway-recombined with LR clonase II (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression vector for 3xFLAG-tagged human MGA produced by the laboratory of Guntram Suske was purchased from Addgene (#107715) and modified by overlap extension PCR to remove residues 1052-3065.
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Cell Biology 2022Quote: ... REEP1-mEmerald and REEP1-mCherry plasmids were generated by inserting a codon-optimized human REEP1 gblock into mEmerald-N1 (gift from M. Davidson; Addgene #53976) or mCherry-N1 backbones (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Synapsin1 promoter and smFP-HA were PCR amplified from pAAV-hSyn-EGFP (a gift from Bryan Roth, Addgene Plasmid #50465) and pCAG_smFP-HA (a gift from Loren Looger ...
-
bioRxiv - Microbiology 2022Quote: To make human ACE2 protein, pcDNA3-sACE2-WT(732)-IgG1 (Chan et al., 2020) (Addgene plasmid #154104, gift of Erik Procko) plasmid was transfected into Expi293 cells using PEI at a ratio of 1:3 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent mCherry under the human synapsin promoter in dHPC (AAV5-hSyn-DIO-mCherry, titer: 1.1 × 1013 vg/ml, Catalog #50459-AAV5, Addgene, Watertown, USA). For optogenetic experiments ...
-
bioRxiv - Biochemistry 2023Quote: ... Human ATAD2B bromodomain-containing protein (residues 953−1085, Uniprot code: Q9ULI0) was a gift from Nicole Burgess-Brown (Addgene plasmid # 39046) was PCR-amplified and cloned into pDEST15 (GlaxoSmithKline ...
-
bioRxiv - Cancer Biology 2023Quote: ... the double-stranded oligonucleotide sgRNAs for human FOXM1 sequences were ligated into the BbsI sites of the FgH1tUTG plasmid (Addgene, #70183). sgRNA target sequences were listed in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA was generated by annealed oligo cloning into a chimeric human codon-optimized SpCas9 and pU6-driven guide RNA expression plasmid (pX330, Addgene #42230) with BbsI digestion (see table S8 for protospacer sequence) ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Cancer Biology 2022Quote: ... A MYC T58A gene (synthesized by IDT, Coralville, USA, using the human MYC T58A sequence as template from Addgene plasmid # 18773) [69] ...
-
bioRxiv - Cell Biology 2023Quote: The DNA fragment encoding human integrin β5 was amplified from the pCX-EGFP beta5 integrin receptor (a gift from Raymond Birge, Addgene #14996), and then inserted into the pEGFP-N1 vector (Clontech ...
-
bioRxiv - Developmental Biology 2023Quote: An enhanced piggyBac Puromycin selectable and DOX inducible vector was digested with EcoRI-NotI and ligated with PCR-amplified human SOX2 from the FUW-tetO-hSOX2 plasmid (Addgene#20724). Transfection into hPSCs was done using Lipofectamine Stem Reagent per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The transgene was constructed using the Gateway recombination system to introduce the Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into the pHAGE-TRE-DEST-NBioTAP (Addgene #53568) lentiviral vector ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... (NM_004458) Human Tagged ORF Clone (cat# RC205356) plasmids and cloned into a 3rd generation lentiviral vector PLJM1-EGFP (Addgene, cat# 19319). The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: The EGFP-tr53BP1 construct was assembled using Gibson Assembly with a fragment of human 53BP1 (amino acids 1221-1709, Addgene #69531) (4 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids constructs pSBbi-RN-FGF19 and pSBbi-BB-FGF15 were respectively generated by cloning the human FGF19 amplified from Huh7 cDNA and the mice Fgf15 amplified from ileum cDNA onto the pSBbi-RN (Addgene #60519) and pSBbi-BB (Addgene #60521 ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of the extracellular region of human TfR1 (residues 89–760) were amplified by PCR and inserted into pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) with EcoRV and XbaI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... One sgRNA was cloned into pMCB320 as detailed above (see “Generation of Single Knockout Cell Lines with sgRNAs from the Bassik Human CRISPR/Cas9 Deletion Library”) while a second sgRNA was cloned into pKHH030 (Addgene #89358). To clone a sgRNA into pKHH030 ...
-
bioRxiv - Immunology 2023Quote: DNA comprised of the human HDAC2 gene with flanking BglII and BamHI restriction sites was synthesized and cloned into pmVenus (L68V)-mTurquoise2 (AddGene #60493) such that a fusion protein of mVenus-HDAC2-mTurqoise2 was produced ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... cells were infected with a lentiviral pool of the Human Brunello CRISPR knockout pooled library (a gift from David Root and John Doench: Addgene #73178) at an MOI of 0.3 and with a coverage of 500 cells per sgRNA ...