Labshake search
Citations for Addgene :
601 - 650 of 1113 citations for Ephrin type A receptor 8 EphA8 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Human MCU-GFP plasmid was a gift from Vamsi Mootha (Addgene plasmid # 31732).
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Cell Biology 2023Quote: A vector expressing HA-tagged human E6AP was obtained from Addgene (Plasmid #8658), E6AP mutants were generated using site-directed mutagenesis (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CRISPR Knockout library was a gift from Michael Bassik (Addgene #101927). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... All the sgRNAs targeting human genes were cloned into lentiCRISPR v2 (Addgene, #52961), lentiCas9-Blast (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Molecular Biology 2024Quote: The gRNA library targeting >1500 human miRNA loci was obtained from Addgene (32). MutuI cells were transduced with lentiparticles derived from the doxycycline inducible Cas9 vector pCW-Cas9 (Addgene Plasmid #50661 ...
-
bioRxiv - Biochemistry 2024Quote: An expression plasmid of human GST-Cdk2 was purchased from AddGene (plasmid #61845) and used without further subcloning ...
-
bioRxiv - Biophysics 2024Quote: The coding sequence of human fascin1 (GeneBank, NM_003088.4) was obtained from Addgene (#31207) and subsequently inserted into a pGEX-6p-1 vector (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: For the generation of stable A549 cell lines expressing various PKCs and mutants we used following plasmids: pcDNA3-PKCε-Flag (wild-type, Addgene, Cambridge, MA), pcDNA3-Flag-K312PKCε ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: The Tau/pET29b plasmid used for wild type FLTau (2N4R) expression and purification was a gift from Peter Klein (Addgene plasmid #1631683).
-
bioRxiv - Cell Biology 2019Quote: ... Lztfl1-/- cells (Figure S2) were obtained by genome editing of immortalized wild type MEFs using guide (gMS04: GCTCGATCAAGAAAACCAAC) cloned into pLentiCrisprV2 (Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells transiently co-expressing individual GFP-tagged RUSH reporter and GalT-mCherry were cultured in complete DMEM supplemented with16 nM His-tagged streptavidin (in-house purified using Addgene #20860, a gift plasmid from A. Ting)(Howarth et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: ... Chronos was manufactured at the University of Pennsylvania Vector Core (AAV2/8.Syn.Chronos.tdTomato, Addgene 62726, 1.6×1013 GC/ml). oChIEF was manufactured by Virovek (AAV2/1.CAG.flex.oChIEF.tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Optimal magnesium concentration was determined to be 8 mM based on expression of the plasmid pJL1-sfGFP (Addgene #69496) encoding superfolder Green Fluorescent Protein (sfGFP).
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 rats were bilaterally injected with DREADDs virus AAV5-CaMKIIα-hM4Di-mCherry (titer, 2.3×1013; Addgene http://addgene.org/50477) and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer ...
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Cell Biology 2019Quote: The human kinome ORF library in pDONOR223 was obtained from Addgene (Cambridge, MA, 1000000014) and cloned into a custom pHAGE-CMV-FLAG destination vector using Gateway cloning technology ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Genomics 2020Quote: Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene #1000000048) (16) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207 ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX6P1-human full-length LIC1 plasmid was a gift from Ron Vale (Addgene plasmid # 74597 ...
-
bioRxiv - Biophysics 2022Quote: The gene with codon-optimized human dysferlin cDNA was obtained from Addgene (Plasmid 67878) [47] ...
-
bioRxiv - Neuroscience 2019Quote: ... and VSV-G envelope generated by inserting human Sirt3 plasmid (Purchased from Addgene #13814) into HIV.SIN.cPPT.CMV.eGFP.WPRE (Purchased from U Penn Vector Core ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B-Raf under T7 promoter was a gift from Dustin Maly (Addgene #40775) and was further modified by the insertion of two additional FLAG tags and of an RBS sequence ...
-
bioRxiv - Physiology 2020Quote: ... Human FL-Dhh sequence was obtained after EcoRI digestion of pBS hSHH (Addgene ID13996) and then cloned at the EcoRI site of pCDNA3.1 myc His to generate the pcDNA3-FL-Shh plasmid ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Neuroscience 2021Quote: ... The human codon-optimized Cas9 (kindly made available by George Church, Addgene plasmid # 41815) and the sgRNA (encoded by a pFUS-U6 vector ...
-
bioRxiv - Biochemistry 2021Quote: The gene encoding human SLC7A11(I.M.A.G.E. clone IRAUp969G0966D) was cloned into pLexM (Addgene 99844) 53 with an N-terminal Flag tag inserted via PCR ...
-
bioRxiv - Cell Biology 2021Quote: Human SEC24D was cloned from pJK15 plasmid into pAcGFP1-C1 (Addgene, Watertown, MA, USA) to generate a GFP-SEC24D fusion gene ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNA to human raptor (plasmid#1857) and rictor (plasmid#1853) were purchased from Addgene. The preparation of shRNA infected HEK293 cells have been described previously (28).
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Immunology 2022Quote: ... An amino-terminal 3xFlag epitope tagged human GLUT3 was generated by PCR (Addgene #72877) (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: Class-switched VRC07 constructs were generated from human isotype backbone plasmids obtained from Addgene. The different human heavy chain constant regions were PCR amplified from the Addgene plasmids and inserted into the previously described AAV transfer vector 11 encoding the VRC07 heavy chain variable region and VRC07 kappa light chain ...
-
bioRxiv - Molecular Biology 2022Quote: The GeCKOv2 human CRISPR knockout pooled library (a gift from Feng Zhang, Addgene #1000000048) was used as described (19 ...
-
bioRxiv - Immunology 2023Quote: ... The amplicons were cloned into human IGHG1 or IGKC or IGLC expression vectors (Addgene number 80795 ...
-
bioRxiv - Neuroscience 2023Quote: ... human TDP-43M337V has subcloned into the pLenti CMV Puro DEST (W118-1, Addgene) plasmid as previously described (Zhang et al ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-expressing DND-41 cells were transduced with Human GeCKOv2 library (Addgene 1000000048, 1000000049) at MOI~0.3 and selected with 1μg/ml of puromycin for 6 days ...
-
bioRxiv - Immunology 2023Quote: ... The CRISPR library vectors (Human CRISPR Metabolic Gene Knockout Library; Addgene, Pooled Library #110066) 12 or the single sgRNA vectors ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...